ID: 1135245714

View in Genome Browser
Species Human (GRCh38)
Location 16:20855280-20855302
Sequence TTGCACTAATGAATATGACT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135245714_1135245717 10 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245717 16:20855313-20855335 CAATTAAGCACAGACGGAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 83
1135245714_1135245723 27 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245723 16:20855330-20855352 AGCTGGGGACCAGGGTCAGAGGG 0: 1
1: 0
2: 1
3: 47
4: 398
1135245714_1135245718 11 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245714_1135245721 19 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245721 16:20855322-20855344 ACAGACGGAGCTGGGGACCAGGG 0: 1
1: 0
2: 0
3: 25
4: 251
1135245714_1135245722 26 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245722 16:20855329-20855351 GAGCTGGGGACCAGGGTCAGAGG 0: 1
1: 0
2: 18
3: 81
4: 561
1135245714_1135245716 4 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245716 16:20855307-20855329 TAAGAGCAATTAAGCACAGACGG 0: 1
1: 0
2: 2
3: 12
4: 224
1135245714_1135245719 12 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245719 16:20855315-20855337 ATTAAGCACAGACGGAGCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 110
1135245714_1135245720 18 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245720 16:20855321-20855343 CACAGACGGAGCTGGGGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135245714 Original CRISPR TTGCACTAATGAATATGACT AGG (reversed) Exonic
905606658 1:39306704-39306726 GTACACTAATAAATAAGACTTGG - Intronic
907147743 1:52251536-52251558 TTCCAGTAATAAATATCACTTGG + Intronic
908369268 1:63465006-63465028 TTGCAATAAAGAACATTACTAGG + Intronic
908826373 1:68136417-68136439 TTGTCCTAAGGAATATGCCTAGG - Intronic
910347192 1:86253510-86253532 AGGCTCTAATGACTATGACTTGG + Intergenic
911402149 1:97388823-97388845 TTACACTAGTGAAAATGATTTGG + Intronic
911519665 1:98913505-98913527 TTGCACAAATGAAAAAGGCTTGG - Intronic
914045775 1:144090890-144090912 TTGCTTTAATGAATAGGCCTTGG - Intergenic
914132335 1:144869797-144869819 TTGCTTTAATGAATAGGCCTTGG + Intergenic
916095827 1:161348960-161348982 TTGCAATAATGAATGAGTCTAGG + Intronic
916294903 1:163207531-163207553 AGGCACAAATGAAAATGACTTGG - Intronic
918328254 1:183431288-183431310 TTGCACTTAAGAATTTGGCTGGG + Intergenic
918509861 1:185299738-185299760 TTGCACCCATGAATGTGGCTAGG - Exonic
919460182 1:197867593-197867615 TTTCACTGATGGATTTGACTGGG - Intergenic
919460318 1:197869544-197869566 TTTCACTGATGGATTTGACTGGG - Intergenic
924437421 1:244054656-244054678 TGGCACTAATGACTATGACATGG + Exonic
1065200618 10:23309653-23309675 ATGCTCTGATGAAGATGACTTGG - Intronic
1068491936 10:57735324-57735346 TTGCACTAATCAAAATACCTTGG + Intergenic
1068872377 10:61959183-61959205 TTGCAACCATGAATATAACTAGG - Intronic
1069159956 10:65080950-65080972 TTGCTCTAAGTAATATGAGTTGG + Intergenic
1071701541 10:87943998-87944020 CTGCAATAATGAAAATGTCTAGG + Intronic
1072478035 10:95782457-95782479 TAGTAAAAATGAATATGACTGGG + Intronic
1074551498 10:114446849-114446871 TTACACTAATGAAAATCAATAGG + Intronic
1077982331 11:7312842-7312864 ATGCAAAAATGTATATGACTGGG - Intronic
1081758973 11:45563746-45563768 TTGAACGAATGAATAGGAGTGGG - Intergenic
1082983940 11:59150491-59150513 ATGCCATGATGAATATGACTTGG + Intronic
1083710234 11:64543536-64543558 TTGAAATAATGAATGAGACTGGG + Intergenic
1089646287 11:119881432-119881454 TTTCACTTAAAAATATGACTTGG + Intergenic
1090077279 11:123587377-123587399 AGGCCCTGATGAATATGACTGGG - Intronic
1090145617 11:124319280-124319302 ATGCACTGAAGAAGATGACTAGG - Exonic
1092565073 12:9656501-9656523 TTTGATTAATGGATATGACTGGG - Intergenic
1092771645 12:11902481-11902503 TGGCACAAATAAATATCACTGGG - Intergenic
1094047601 12:26184293-26184315 TAGCACTAAGGAAAATGAGTAGG - Intronic
1094523493 12:31217067-31217089 TTGCATTAATGAAAAGGATTAGG + Intergenic
1095257465 12:40055675-40055697 TTTCCCTAATGAATATCATTAGG - Intronic
1096836121 12:54352360-54352382 TCGCACAAATGAATGTGGCTGGG + Intergenic
1099983424 12:89633953-89633975 TTAGAATAATTAATATGACTTGG + Intronic
1102746393 12:115252372-115252394 TTGCACTCATGCAGAGGACTTGG - Intergenic
1106973672 13:35178615-35178637 TTCCACCAATGATTATGTCTAGG + Intronic
1108233151 13:48371402-48371424 TTCCACTGAGGAATATGCCTAGG + Intronic
1111745352 13:92260970-92260992 TTGAAATAATGAGTATTACTGGG + Intronic
1112001676 13:95216018-95216040 TGACATAAATGAATATGACTTGG - Intronic
1113423579 13:110188955-110188977 CTGCACTGTTCAATATGACTTGG + Intronic
1114811009 14:25899450-25899472 TTGCACTACTGAATAGGCATTGG + Intergenic
1114843563 14:26294156-26294178 TTGAACTAAGGAATCTGACCTGG - Intergenic
1115206043 14:30906006-30906028 TTGGACTCATGAAAATGGCTTGG + Intronic
1116201100 14:41797761-41797783 TGGAACAAATGAATATCACTGGG - Intronic
1117657723 14:57973592-57973614 TTGCATTATGGGATATGACTTGG + Intronic
1124829700 15:33136300-33136322 TTGCACAAAAGTATATGTCTTGG + Intronic
1125776702 15:42222399-42222421 CTGCACTTATAAATATGATTAGG + Intronic
1132162463 15:99555949-99555971 TTGCTCTAATTAATATGAGATGG + Intergenic
1133495129 16:6310684-6310706 TGTCACTCATGAATATGACTGGG + Intronic
1135014484 16:18913563-18913585 CTCCACTAATGAATATGTCTTGG - Intronic
1135245714 16:20855280-20855302 TTGCACTAATGAATATGACTAGG - Exonic
1136331640 16:29582879-29582901 CGCCACTAATGAATATGTCTTGG - Intergenic
1136446280 16:30322621-30322643 CGCCACTAATGAATATGTCTTGG - Intergenic
1140344604 16:74200810-74200832 TGGCACAAATGCATTTGACTTGG - Intergenic
1142795017 17:2300949-2300971 TTGGATTTCTGAATATGACTTGG - Intronic
1146757212 17:35443489-35443511 TTGCCCAAATGCATATGGCTAGG + Intronic
1148350887 17:46941259-46941281 TTGCCCTGATGAATTTGAATGGG + Intronic
1148781479 17:50124395-50124417 TTGCACTTATTTATGTGACTTGG + Intronic
1153614430 18:6921197-6921219 TTGCATAAATGAACATGATTGGG + Intergenic
1153706063 18:7747214-7747236 TTGCAGTAATGCGTATGTCTGGG - Intronic
1155257451 18:24011267-24011289 TTGCACCAATTAATGTGAGTAGG - Intronic
1155277464 18:24202278-24202300 CTGCACTAAGGAAAATGCCTAGG + Intronic
1157558518 18:48629616-48629638 TTGCTCTAAACAATATTACTGGG - Intronic
1159248725 18:65845508-65845530 TTGCCCCAATTAATATAACTTGG - Intronic
1159789492 18:72760324-72760346 TTGCACAAATGCATATGTATTGG - Intronic
1160066470 18:75579311-75579333 ATGGACAAATGCATATGACTTGG + Intergenic
1162674453 19:12288337-12288359 TTGCACAAATTAAAATGTCTTGG - Intronic
1164820339 19:31245382-31245404 TTGCTCATATGAATCTGACTAGG + Intergenic
1168716895 19:58534259-58534281 TTGGAGTAATGAAAATGACTTGG + Intronic
926766696 2:16328506-16328528 TTGCACTATTTACTGTGACTGGG + Intergenic
928496264 2:31835612-31835634 TTGCACTTATGAAAATCTCTTGG - Intergenic
929548416 2:42873029-42873051 TTTCTCTAATGAATATTTCTTGG + Intergenic
929748205 2:44681405-44681427 CTGCATTAATAAATAGGACTGGG - Intronic
930468568 2:51784391-51784413 TTGGACAAATGAATATGGCAGGG + Intergenic
930561495 2:52965043-52965065 TCTCACTAGTGAATATGAATGGG - Intergenic
933568920 2:83984607-83984629 ATGCACTAATGAAGTTTACTAGG + Intergenic
934124557 2:88874631-88874653 TTTCATTGATGAAAATGACTTGG + Intergenic
934163827 2:89276156-89276178 ATGCACCAATGGAGATGACTCGG - Intergenic
934203445 2:89906368-89906390 ATGCACCAATGGAGATGACTCGG + Intergenic
935334755 2:102006169-102006191 GTGCACTAATGAGTCTGGCTTGG + Intronic
936167399 2:110134641-110134663 TTTCATTAATAAATTTGACTTGG - Intronic
936876563 2:117196796-117196818 TGGCTATAATGAATAAGACTGGG - Intergenic
936952184 2:117988938-117988960 CTGCACTAAACAGTATGACTTGG + Intronic
936982136 2:118274847-118274869 TTGCATGAATGAACATGGCTAGG + Intergenic
939133623 2:138267910-138267932 TTGTAATCATTAATATGACTTGG + Intergenic
941949911 2:171144252-171144274 TTTCAATAATGAATAGAACTAGG + Intronic
942281492 2:174368521-174368543 TTGAACTAAAGAAAATGGCTGGG + Intronic
944216301 2:197259616-197259638 TTGAATTAATGACTATGAGTTGG - Intronic
945041769 2:205748662-205748684 TTGCACTACTGTATGTGATTAGG - Intronic
946668278 2:222074255-222074277 TTGGACAAATGACCATGACTAGG - Intergenic
1169820212 20:9702130-9702152 TTAAACTAATGAAAATGACTGGG + Intronic
1170487984 20:16839339-16839361 TTCCACTAACCCATATGACTGGG + Intergenic
1171128376 20:22624714-22624736 TTTCCCTACTGAATTTGACTAGG + Intergenic
1173657225 20:44708129-44708151 TTTCACTTATGAATATGGATAGG + Intergenic
1179103826 21:38380582-38380604 ATGCAATTATGAATATGACCTGG + Exonic
1182407990 22:30154548-30154570 TTGCCATAATGGATATTACTGGG - Intronic
1183370563 22:37429375-37429397 TTGCACTCTGGAAGATGACTGGG - Intergenic
949696965 3:6708815-6708837 TTGTACTAATTTACATGACTAGG + Intergenic
951203961 3:19906023-19906045 TAGAACTAATGAATTTGGCTGGG + Intronic
951393205 3:22132127-22132149 TTCAACAAATGAATATGACATGG - Intronic
953968990 3:47332577-47332599 TTAAACTAATTAATATGACGGGG + Intronic
956781732 3:72608583-72608605 CTGGACTAATGGATAAGACTTGG - Intergenic
958714185 3:97759476-97759498 ATCTACTAATGAAAATGACTTGG + Intergenic
964635009 3:158848820-158848842 GGGGGCTAATGAATATGACTTGG + Intergenic
966565846 3:181380425-181380447 TTACACTAATGAATACTAATTGG - Intergenic
969037131 4:4263590-4263612 TTTCACTAATGGAGATGAATTGG + Intergenic
970726431 4:19050822-19050844 TTGCAAAAATGAATAAAACTAGG - Intergenic
971672150 4:29575448-29575470 TTGGCCTAATGAATAAGACATGG + Intergenic
972427833 4:38951105-38951127 TAGCATTAATGATTATGATTGGG + Intergenic
972885644 4:43483173-43483195 GTGCACAAATGTATATGCCTAGG - Intergenic
972936739 4:44145656-44145678 TTGCTATAATGCATATGACTAGG - Intergenic
977139936 4:93356983-93357005 TTTCACTAATGAAAATAATTTGG + Intronic
978498257 4:109383173-109383195 TTGCACTGATAAATATGAATTGG + Intergenic
979854770 4:125618108-125618130 TTGCACTGAAGGATCTGACTAGG + Intergenic
980488930 4:133499485-133499507 TGACCCTAATTAATATGACTTGG + Intergenic
981853936 4:149264637-149264659 GTGCATTAGTGAATATGAATGGG - Intergenic
983280407 4:165673921-165673943 TTGGACTGATGAATGTGCCTAGG + Intergenic
983806828 4:172004078-172004100 GTCCACTTATGAATATTACTAGG - Intronic
984396844 4:179212579-179212601 TTGAACTACCGAATATGATTTGG + Intergenic
987268960 5:16285284-16285306 TTGCACTAGAGAAAACGACTTGG + Intergenic
987749236 5:22018388-22018410 TTGGATTAATGAAGATAACTGGG + Intronic
989665176 5:43845945-43845967 TTGAAGTAATCAATATAACTAGG + Intergenic
989841014 5:46069876-46069898 TTGCACTACTTAATATTTCTTGG - Intergenic
993954422 5:94215003-94215025 TTTCATTAATGAATATGAATAGG - Intronic
994711143 5:103265575-103265597 TTGAACACATGAATAGGACTAGG + Intronic
994824038 5:104690114-104690136 TTTATATAATGAATATGACTTGG - Intergenic
997407067 5:133657985-133658007 TTAAAATAATGAATATGAATAGG + Intergenic
998055986 5:139077844-139077866 GTGCACTAAAGCATATGATTTGG - Intronic
1000818580 5:165955606-165955628 TTGCTGTAATGAACAAGACTGGG - Intergenic
1003294160 6:4809221-4809243 TTTCACTTATCAATATGTCTTGG + Intronic
1007936591 6:45737887-45737909 TTCCCTGAATGAATATGACTTGG - Intergenic
1008179180 6:48306668-48306690 TTGCACTAAGGTATTTGAGTAGG + Intergenic
1010620963 6:78073914-78073936 TTTCCCTAATGACTATGAGTAGG + Intergenic
1011027002 6:82880401-82880423 TCACACTAATGAATAAGACCAGG + Intergenic
1013969661 6:116001672-116001694 TTGCATAAATGAAACTGACTGGG + Intronic
1013970426 6:116011646-116011668 TTGTCCTCATGAATGTGACTTGG + Intronic
1023758602 7:43443517-43443539 TTGCACTAATGCATTTGAAATGG + Intronic
1024329980 7:48146039-48146061 TTCCACTAATCCAGATGACTGGG + Intergenic
1025523628 7:61775344-61775366 TTGCACTAAATAACATCACTTGG + Intergenic
1027615058 7:80412254-80412276 TTGCACAAATAATTATTACTTGG + Intronic
1027966979 7:85024744-85024766 TTGCACAAATGAAAATGATTTGG + Intronic
1028113567 7:86972300-86972322 TTGCACAAATGAATCTGATTGGG + Intronic
1028924127 7:96339419-96339441 TTGCACTATTGCATTAGACTAGG + Intergenic
1029055808 7:97741277-97741299 GTGTACTAAGGAATATGAGTTGG - Intergenic
1036033638 8:4996282-4996304 TTGCAGTCCTGAACATGACTTGG + Intergenic
1036474244 8:9078648-9078670 ATGCACAGATGAAAATGACTTGG - Intronic
1037338311 8:17813559-17813581 TTGCAGTAGTGAATAAAACTTGG - Intergenic
1042232370 8:66571257-66571279 GTTCACGAATGAATAGGACTGGG - Intronic
1044226823 8:89728813-89728835 TTGCACTACTGGCTAAGACTTGG - Intergenic
1044871757 8:96626681-96626703 TAGCTTTAATGCATATGACTTGG - Intergenic
1045716705 8:105055564-105055586 TTTCTCTAATGAATATGGCATGG - Intronic
1045962500 8:107984161-107984183 TTGAGCTAATGATTCTGACTTGG + Intronic
1046183926 8:110688869-110688891 TTTCACTAATGTAGATGTCTAGG - Intergenic
1046547860 8:115674149-115674171 TTGCACTGCTGATTATGATTTGG - Intronic
1049191336 8:141289540-141289562 TTGTACAAATGGGTATGACTGGG + Intronic
1049378338 8:142300123-142300145 TAGCTCTAATGAAGATGATTTGG - Intronic
1052647948 9:31261937-31261959 TTTTACTAATCAATATGTCTTGG + Intergenic
1053813184 9:41876066-41876088 TTGCACCAATGGATAAGAATAGG - Intergenic
1054617411 9:67311373-67311395 TTGCACCAATGGATAAGAATAGG + Intergenic
1054751829 9:68915251-68915273 TAGCACTGATAAATATGAGTAGG + Intronic
1058787035 9:108399208-108399230 TTGCTCTAATGAATATTAATAGG + Intergenic
1058930868 9:109717424-109717446 TGGCACAAATGAAGATGATTTGG - Intronic
1186032478 X:5384810-5384832 TTGAACTGTTCAATATGACTAGG - Intergenic
1186991297 X:15071535-15071557 TAGCATTAATGATAATGACTAGG - Intergenic
1187233430 X:17444132-17444154 TTGTACTAATGCATATGTGTGGG - Intronic
1189488654 X:41452540-41452562 CTGTACAAATGAATATTACTAGG - Intronic
1192545648 X:72010626-72010648 TTTCACTTAGGAATATGTCTTGG + Intergenic
1193524194 X:82568563-82568585 TTGCAGGAATGAATCTGACTTGG + Intergenic
1195538214 X:106033209-106033231 TTGCTCTAATAAATTTGACTGGG - Exonic
1195755766 X:108197261-108197283 TTGTAGCCATGAATATGACTTGG + Intronic
1196273699 X:113741526-113741548 TTTCAGTAATGAATATGACCTGG - Intergenic
1198542724 X:137657146-137657168 CTGCCCTAATGAAGAAGACTTGG - Intergenic
1199736171 X:150688733-150688755 TTACACGCATGAAAATGACTTGG - Intergenic
1200374933 X:155769743-155769765 TTAAAGTAATGAATAGGACTAGG + Intronic
1202588296 Y:26455317-26455339 TTGCTTTAATGAATATGCCTTGG + Intergenic