ID: 1135245718

View in Genome Browser
Species Human (GRCh38)
Location 16:20855314-20855336
Sequence AATTAAGCACAGACGGAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135245714_1135245718 11 Left 1135245714 16:20855280-20855302 CCTAGTCATATTCATTAGTGCAA 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245712_1135245718 21 Left 1135245712 16:20855270-20855292 CCCTTTAAAACCTAGTCATATTC 0: 1
1: 0
2: 1
3: 29
4: 259
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245710_1135245718 23 Left 1135245710 16:20855268-20855290 CCCCCTTTAAAACCTAGTCATAT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245713_1135245718 20 Left 1135245713 16:20855271-20855293 CCTTTAAAACCTAGTCATATTCA 0: 1
1: 0
2: 4
3: 17
4: 238
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92
1135245711_1135245718 22 Left 1135245711 16:20855269-20855291 CCCCTTTAAAACCTAGTCATATT 0: 1
1: 0
2: 0
3: 23
4: 227
Right 1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135245718 Original CRISPR AATTAAGCACAGACGGAGCT GGG Exonic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
903088275 1:20883664-20883686 AATAAAGGACAGAAAGAGCTAGG + Intronic
906074845 1:43044447-43044469 AATTAAGCCCAGATGAGGCTGGG + Intergenic
908139224 1:61166396-61166418 TATGGAACACAGACGGAGCTGGG - Intronic
914391316 1:147225587-147225609 AAGCGAGCACAGACGGGGCTAGG - Exonic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
1069726096 10:70580022-70580044 ACTTAAGCACAAAAGGATCTGGG - Intergenic
1075640226 10:124059465-124059487 GATTAAGGACAGAAGGAGCAGGG + Intronic
1077205652 11:1342348-1342370 AATTCAGTACACCCGGAGCTTGG + Intergenic
1077782664 11:5348533-5348555 AATTAAGCTTGGACGGAGCTTGG + Intronic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1081428095 11:42947308-42947330 AGCTAAGCAGAGATGGAGCTGGG - Intergenic
1083274442 11:61588668-61588690 AATGAAGCAGCCACGGAGCTGGG - Intergenic
1083383290 11:62286574-62286596 AATTATGCACTCAGGGAGCTTGG - Intergenic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1096169852 12:49459130-49459152 ATTTAAGCAGAGAAGGAGATGGG + Intronic
1096814263 12:54191758-54191780 AAGTGAGCAGAGTCGGAGCTAGG - Intergenic
1099909634 12:88813801-88813823 AATTAAGCAAATAGGGAGGTTGG - Intergenic
1105303138 13:19152700-19152722 AATGATGCACAGACAGAGGTAGG + Intergenic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG + Intergenic
1120751242 14:88200442-88200464 AATTAGGTACACACGTAGCTGGG - Intronic
1126866954 15:52947279-52947301 AATTAAGCACACAAATAGCTTGG - Intergenic
1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG + Intergenic
1130459833 15:84152692-84152714 GATAAAGCACAGACAGAGCCAGG - Intergenic
1132611619 16:819608-819630 TATTTAGCACAGCCTGAGCTGGG + Intergenic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1138574318 16:57897780-57897802 AAATAAGGTCAGACGCAGCTGGG - Exonic
1138730422 16:59187992-59188014 AATTAAGCAGAGACGATGATAGG + Intergenic
1139243021 16:65413272-65413294 AATGAGGCGCAGACGGAGCATGG + Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1143982210 17:10879849-10879871 AGTTAAGCAGACACTGAGCTGGG - Intergenic
1157955185 18:52089121-52089143 AGGTAAGGACAGAGGGAGCTAGG - Intergenic
1158089440 18:53693728-53693750 AAATAACCACAGACTGAACTTGG - Intergenic
1162341753 19:10095429-10095451 AATAAAGTGCAGACAGAGCTGGG + Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
926806912 2:16719563-16719585 TGTTAAGCACAGTCTGAGCTGGG + Intergenic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
933334746 2:80943464-80943486 AAAAAAGCACAGGCGGAACTAGG - Intergenic
933367139 2:81367367-81367389 ATTTAAGCACAGAACTAGCTTGG + Intergenic
945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG + Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
948119119 2:235515810-235515832 AATTAAACACGCACAGAGCTGGG + Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1172038139 20:32024837-32024859 AAATAACCACAGACTGTGCTGGG + Intronic
1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG + Intronic
1174400114 20:50271431-50271453 AATGAAGCACCCACTGAGCTGGG + Intergenic
1176213540 20:63937753-63937775 AATTAATCACAGTCGGTCCTGGG + Intergenic
1179126461 21:38595385-38595407 AATTAAGCAGAGAAGGTGCAGGG + Intronic
1182835953 22:33341488-33341510 AATAGAGGACAGAGGGAGCTGGG - Intronic
1184358264 22:43996868-43996890 ACTGAAGCAAAGACGGAGCCTGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
968258028 3:197297432-197297454 AATTAAGAACAGACAGAAGTCGG + Intronic
972750784 4:41986559-41986581 AATTAAGCTGAGACAGAGCATGG - Intergenic
972907308 4:43767250-43767272 AATTCATATCAGACGGAGCTAGG + Intergenic
973884475 4:55306616-55306638 AAGAAAGCACAGGCGGAACTGGG + Intergenic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
976401393 4:84611000-84611022 AAGAGAGCAAAGACGGAGCTGGG + Intronic
980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG + Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
984081420 4:175253493-175253515 AATTAAGCACAGTGGGAACCAGG + Intergenic
988907561 5:35804805-35804827 AATTAAGCAAAGAAGGAACCTGG - Intronic
989327543 5:40217035-40217057 ATTTAAGCACTGACGGTGCCTGG - Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG + Intergenic
993904606 5:93608978-93609000 AATTAACAACACACAGAGCTCGG + Intergenic
995391329 5:111643033-111643055 AAGTAAGCACGGAAAGAGCTTGG - Intergenic
995601400 5:113800959-113800981 AATTTAGCAAAGACAGAACTAGG + Intergenic
996195392 5:120600140-120600162 AATTAAACAAAAATGGAGCTGGG - Intronic
998791776 5:145773577-145773599 AATTAAGCACAGATGGACTAAGG - Intronic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1011717186 6:90119289-90119311 AATTAGGTAAAGACAGAGCTGGG - Intronic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1017768199 6:157624150-157624172 AATTAGGCACAAGCTGAGCTGGG - Intronic
1019789398 7:3001072-3001094 AATTAATCACGGCTGGAGCTGGG - Intronic
1027250354 7:76395087-76395109 AATTATGAGCAGACGGAGCAAGG - Intronic
1028838894 7:95404843-95404865 AATTAAACACAGACAAAACTGGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1034488313 7:151380064-151380086 ACTTAAGCACACACAGACCTCGG - Intronic
1041389213 8:57334149-57334171 AAGGAAGCACAGACGGAGAATGG - Intergenic
1041947644 8:63464182-63464204 AATAAAGCACAGAAGGTGCCTGG - Intergenic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1057221617 9:93260571-93260593 GATTCAGCACTAACGGAGCTGGG - Intronic
1057660655 9:96998526-96998548 AATTAAGCACAGGCTGGGCACGG + Intronic
1187826936 X:23340928-23340950 AATTAAGGAGAGACTGAGATCGG + Intronic
1191220060 X:57978319-57978341 AATAAAGCACAGAAGCATCTGGG - Intergenic
1194087907 X:89551942-89551964 AATTAAGCACAGAATGATTTGGG - Intergenic
1200440713 Y:3208859-3208881 AATTAAGCACAGAATGATTTGGG + Intergenic