ID: 1135246024

View in Genome Browser
Species Human (GRCh38)
Location 16:20857792-20857814
Sequence CCTCTGAAGGAGGAACTGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135246016_1135246024 8 Left 1135246016 16:20857761-20857783 CCGTGGGTGATCTTAAAGTTTCC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG 0: 1
1: 0
2: 2
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135246024 Original CRISPR CCTCTGAAGGAGGAACTGTC AGG Exonic
902275550 1:15337044-15337066 CCTCTGCAGGAGGGGCTGCCAGG + Intronic
903613658 1:24635988-24636010 CCTATGTAAGAGGAACTGTTTGG - Intronic
904293903 1:29505518-29505540 CCCCTGAAGCTGGAGCTGTCAGG + Intergenic
911565325 1:99457095-99457117 CCTTTGAAGAGGGAACTGCCTGG + Intergenic
914777086 1:150747229-150747251 ATTCTGAAGGAGGAACAGTATGG + Intronic
916728052 1:167541197-167541219 CCTCTTAAAGAGGAAATGTCAGG - Exonic
920441308 1:205982673-205982695 CCTCTGAAGTCGGAACGATCTGG - Intronic
920718661 1:208366477-208366499 GCTCTGAAGGAGGATATGTCGGG + Intergenic
921853950 1:219961663-219961685 CATCTGAAGGAAGATCTTTCTGG + Intergenic
1063505628 10:6595767-6595789 CCTTTGAAGGAGACACTGTAAGG + Intergenic
1065309653 10:24402832-24402854 CCTCTGAAGGAGATCCAGTCTGG + Intronic
1066462084 10:35620969-35620991 CCTCTGAGGGATGGACCGTCTGG + Intergenic
1067481681 10:46603946-46603968 CCTCTTAAGGAAGAGCTGTGGGG + Intergenic
1067613070 10:47737781-47737803 CCTCTTAAGGAAGAGCTGTGGGG - Intergenic
1067791658 10:49292956-49292978 CCACTGAAGCAGGAACTCTGAGG + Intergenic
1068081107 10:52318307-52318329 TCACTGAAAGAGGAACTGGCAGG + Intergenic
1070300883 10:75202734-75202756 CTTCTGAAGGAGGGACTCTGAGG - Intergenic
1070333879 10:75437770-75437792 CCTCTGGAGGAGGGACATTCAGG + Intronic
1070679205 10:78436932-78436954 CCACAGAAGGAAGAACTTTCCGG - Intergenic
1071628487 10:87197887-87197909 CCTCTTAAGGAAGAGCTGTGGGG - Intergenic
1073428012 10:103467957-103467979 TCTCTAAAGAAGGAACTGTAGGG - Intergenic
1074342084 10:112641887-112641909 CCGCAGAAAGAGGAACTGTTGGG + Intronic
1075162729 10:120039071-120039093 CTTCTTAAAAAGGAACTGTCTGG - Intergenic
1076164090 10:128268237-128268259 CCTCTCCAGGAGGAACCCTCGGG - Intergenic
1077119313 11:899555-899577 TGTCTGAAGGAGGAAGTGTGGGG + Intronic
1077198053 11:1291402-1291424 ACTGGGAAGGAGGAACTGGCGGG - Intronic
1077398983 11:2343689-2343711 CCAGTGTAGGAGGAACTGTCTGG - Intergenic
1078353156 11:10612064-10612086 CCTCTGAAGGAGTGAATGGCAGG + Intronic
1080853399 11:36090911-36090933 CTTAGGAAGGAGGAACTGACAGG + Intronic
1081499347 11:43650623-43650645 TCTCTAAAGGAGGAAATGTGAGG + Intronic
1083322115 11:61854199-61854221 CCTCTGGAGGAGGAGATGTGTGG + Intronic
1088658685 11:112025808-112025830 CCTCTCAAGGAGGATCTTGCAGG - Intronic
1089358547 11:117871507-117871529 GCTCTCAAGGAAGAACTGACAGG + Intronic
1090771326 11:129921947-129921969 CCTCTGCAGGAGGAAGTGCTTGG + Intronic
1091178417 11:133581643-133581665 CCACTGATGGAAGAGCTGTCTGG + Intergenic
1091585400 12:1813270-1813292 CCCCTGAAGGAGAAACTCTGGGG - Intronic
1091600105 12:1912828-1912850 CCTGTGAAAGAGGAAATGACAGG - Intronic
1092161367 12:6317161-6317183 CCTGGGAGGGAGGGACTGTCAGG + Intronic
1094500642 12:31018044-31018066 CGTCTGGAGGGTGAACTGTCTGG - Intergenic
1097279968 12:57839069-57839091 CATATGAAGGAGGAACTGGTTGG - Intronic
1100284980 12:93156580-93156602 CCTCTGAAAGAGGGACTCTCAGG + Intergenic
1100774862 12:97962810-97962832 GCTGTGAAGTAGGAACAGTCTGG - Intergenic
1101316396 12:103632808-103632830 CCTGTGAAGGAGAAACTCACAGG + Intronic
1102330641 12:112026220-112026242 GATCTGAATGATGAACTGTCAGG - Intergenic
1104482067 12:129116086-129116108 CCTCTGGAGGAGGCCCTGGCTGG - Intronic
1106591378 13:31101654-31101676 TCTCTGAAGCAGCAAGTGTCTGG + Intergenic
1107045263 13:35986623-35986645 CCTCTCAAGGAGCTAATGTCAGG - Intronic
1107722702 13:43265896-43265918 ATTCTCAAGGAGGACCTGTCTGG - Intronic
1111881009 13:93957042-93957064 CCTGTGAAGGACAAAATGTCTGG + Intronic
1112133330 13:96548233-96548255 CTACTGAAGGAGGAAGAGTCTGG - Intronic
1112808401 13:103188004-103188026 CCTCTGAAAGAGGCTCTGTGGGG - Intergenic
1113906985 13:113823901-113823923 GCTCTGAGGAAGGAGCTGTCAGG - Intronic
1114537985 14:23435072-23435094 CCTCTGCAGAAGGAACTCACAGG - Intronic
1115223963 14:31084832-31084854 CCTTTGAATGATGAACTGTCTGG - Exonic
1117073954 14:52082060-52082082 CCTGTGAAGGGGGTGCTGTCTGG + Intergenic
1117142747 14:52806402-52806424 TCAATGCAGGAGGAACTGTCAGG + Intergenic
1117613649 14:57509731-57509753 TCTCTGAGGCAGGAAGTGTCTGG + Intergenic
1118572003 14:67203255-67203277 TCTCTGCAGGAGGAGATGTCAGG - Exonic
1119815396 14:77561933-77561955 CCACTGAGGGAGGAAAGGTCTGG + Intronic
1120488858 14:85151108-85151130 ACTCTGTAGCAGGAAGTGTCTGG + Intergenic
1120833909 14:89023275-89023297 CCCCTGATGGAGGGACTGGCAGG + Intergenic
1121329268 14:93039919-93039941 CCTCTGGAGGAGGCCCTGTGGGG - Intronic
1121751625 14:96362917-96362939 CCTCTGCAGGAGGTACCGGCAGG + Exonic
1202906019 14_GL000194v1_random:72915-72937 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1131846852 15:96497384-96497406 CCTCTGGATGGGGAACAGTCTGG + Intergenic
1134186328 16:12087935-12087957 CTTTTGAAGGAGGACCTGTTGGG + Exonic
1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG + Exonic
1135395455 16:22128272-22128294 GCTGTGAAGGAGGAACTGAAGGG + Intronic
1137745335 16:50816279-50816301 CCTCCCAAGGATGAGCTGTCAGG + Intergenic
1137869582 16:51936918-51936940 CCTCTGAAGTAGGCACAGTTAGG + Intergenic
1139074565 16:63428410-63428432 TCTCTGTAGGAGGAACTCCCAGG - Intergenic
1139216197 16:65125939-65125961 CCTTTGATGAAGGAACTGACAGG - Intronic
1139295637 16:65898099-65898121 CCTCTGCAGCAGGCACTGTGTGG + Intergenic
1139916839 16:70433573-70433595 TATCTGAGGGAGGAAGTGTCTGG - Intronic
1140785774 16:78340628-78340650 CCTCTGAAGGATGATCTGGCTGG + Intronic
1143228359 17:5328167-5328189 CCTCTGAGGTAACAACTGTCAGG - Intronic
1144021962 17:11245590-11245612 ATTCTGAGGGAGGAACTGTGTGG + Intronic
1144932901 17:18874592-18874614 GCTCTGAAGGAGGAAGGGTGTGG + Intronic
1145285106 17:21499864-21499886 CATCTGAAGCAGGGACAGTCTGG - Intergenic
1146227540 17:31079833-31079855 CATTTGAATGAGGAAATGTCTGG - Intergenic
1146976710 17:37119770-37119792 CCTATGAGGGAGGAAATGCCTGG - Intronic
1147264504 17:39226417-39226439 CATCACAAGGAGGAATTGTCCGG - Intergenic
1148786549 17:50148805-50148827 CCTCTGGAGGAAGGAATGTCCGG + Intronic
1149210638 17:54296320-54296342 CTTCTGGAGGAGGAACTGTGTGG - Intergenic
1150450336 17:65261330-65261352 CCACTGAGGCAGGAAGTGTCTGG - Intergenic
1150824588 17:68463355-68463377 CCTCTGAAGGAGGAGAAGTTTGG + Intergenic
1154388336 18:13915493-13915515 GCTCTGAAGCAGGAACTTTCTGG + Exonic
1160025606 18:75212501-75212523 TCTCTGGAGGAGGAACTGGCAGG + Intronic
1164567647 19:29339385-29339407 TCTCTGAAGGAGATGCTGTCAGG - Intergenic
1164816570 19:31208759-31208781 CCTCTGAAAGAGGAACAGTGTGG - Intergenic
1166147017 19:40844899-40844921 CCTCTGATGGAGGAGCTTTGGGG + Intronic
1166151175 19:40876795-40876817 CCTGTGAAGGAGGAGCTTTGGGG + Intronic
1166179129 19:41094810-41094832 CCTCTGAGGGAGGAGCTTTGGGG - Intronic
1167449282 19:49557346-49557368 CCTCTGATGGAGGCACTATGTGG + Intronic
924988385 2:289983-290005 CCTCAGGAGGAGAAAGTGTCCGG + Intergenic
926122721 2:10253714-10253736 CCTCGGAAGGAGGAGCTGCTGGG - Intergenic
926230867 2:11002914-11002936 CTTCTCAAGAAGGAACTGACGGG + Intergenic
928042290 2:27890604-27890626 GCGCTGAGGAAGGAACTGTCAGG + Exonic
928684376 2:33733201-33733223 CCTCTGGCGGAGGAACTGGGTGG - Intergenic
931757207 2:65384745-65384767 CCTCTGAATGGGGACCTGACAGG - Intronic
932782338 2:74568399-74568421 CCTCTGGAGAAGGAAGAGTCCGG + Intronic
933147761 2:78875954-78875976 CCTTTGAGGTAGGAACTATCAGG + Intergenic
934537909 2:95151645-95151667 CTTCTGAAGAAGGAAATGACTGG + Intronic
936259836 2:110949235-110949257 CCTCCCAAGAAGGATCTGTCTGG + Intronic
936508295 2:113125589-113125611 CCTTTGAAGGATTAACTCTCTGG + Intronic
937479671 2:122245062-122245084 CCTCCTAAGGAGTAACTGCCAGG - Intergenic
937857558 2:126683444-126683466 ACTCTGAAGGAGGAAGAATCTGG - Intronic
937949265 2:127371208-127371230 CCTCTAGAGGAGGTACTGGCTGG - Intronic
938909585 2:135874402-135874424 GCTTTGAAGGAGGAACTATCAGG + Intronic
944333796 2:198504451-198504473 TATCTTAAGGAGGAACTGTTTGG - Intronic
945712498 2:213316281-213316303 TCTCTGATGGATCAACTGTCAGG - Intronic
947823652 2:233089760-233089782 CCTATGAAGGAGGGACTTTGAGG - Intronic
948892637 2:240914848-240914870 CATCTGAAGCAGGGACGGTCAGG - Intergenic
1168763020 20:362596-362618 CCTGTGATGGAAGAACTGACAGG + Intergenic
1171149671 20:22816058-22816080 CCTCTGGATGAGGAACTCACTGG + Intergenic
1171184129 20:23112691-23112713 CCTGTGCTGGAGGAGCTGTCTGG - Intergenic
1173236287 20:41248819-41248841 CCACTGAAGCAGGAATTGGCTGG + Intronic
1175250305 20:57605186-57605208 CCACTCAAGGAGGAAGTGACAGG + Intronic
1175372537 20:58501660-58501682 CGTGTGGAGGTGGAACTGTCAGG - Intronic
1175522064 20:59608439-59608461 CCTCTGAAGGAGGAAAGATCAGG - Intronic
1176625374 21:9087671-9087693 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1178944983 21:36939582-36939604 CCTTACAGGGAGGAACTGTCTGG - Intronic
1179526216 21:41977605-41977627 CCTCTGAAGGTGGAGCTGACGGG - Intergenic
1182403835 22:30106621-30106643 CCCCTCAATGAGGAACAGTCAGG - Intronic
1184116075 22:42423156-42423178 CTGCTGAAGGAGGCACTCTCTGG - Intronic
1184482503 22:44756100-44756122 CCACTGAAGAAAGAACTGTTTGG - Intronic
949956031 3:9269380-9269402 GCTCTGCAGGAGACACTGTCTGG - Intronic
950028118 3:9834538-9834560 CCTCTGGAGGAGGAACCGGGAGG + Intronic
950307709 3:11929089-11929111 CCTCTGTAGCAGGGACTGACAGG - Intergenic
950428751 3:12938892-12938914 CCCCTGGGGGAGGAACTGCCAGG - Intronic
950523294 3:13509005-13509027 CCTCTGCAGGTGGAACAGGCAGG - Intergenic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
956486234 3:69724837-69724859 TCTCTGTAGCAGGAACTCTCAGG + Intergenic
960720704 3:120622393-120622415 CCCCTGGAGGAGGGACTGGCAGG + Intergenic
965660645 3:171038467-171038489 CCTATGAAGGAGGCACTGTTAGG - Intergenic
966118801 3:176498777-176498799 CATGTGAAGGAGGAACTGTCAGG + Intergenic
968447662 4:660461-660483 CCACAGAAGGAGGAGCTGCCAGG + Exonic
969323040 4:6424609-6424631 CCTCTGGAGGAGGCATTGGCTGG - Intronic
971489793 4:27199351-27199373 CCTCCAAAGGAGTAACTGTCAGG - Intergenic
974003947 4:56537172-56537194 CCTGAGAAGGAGAAACAGTCAGG - Intronic
975732789 4:77354048-77354070 CCTGTGGAGAAGGAACTGGCAGG + Intronic
975734379 4:77367144-77367166 CCTGTGGAGAAGGAACTGGCAGG + Intronic
976382659 4:84418015-84418037 TCTTTGAAGGAGGAACTTTTTGG - Intergenic
977430225 4:96922873-96922895 GCTCTGCAGAAAGAACTGTCTGG + Intergenic
979461448 4:120989179-120989201 CCTCTCAAGGAGTAACTTTATGG + Intergenic
981104534 4:140865513-140865535 CTTCTGAAAGAGAAACTTTCTGG + Exonic
985604496 5:851136-851158 CCTCTCAGGGAGGATCTGGCAGG - Intronic
985731918 5:1554086-1554108 CCGCTGGTGGAGGAACTGGCAGG + Intergenic
986069567 5:4268909-4268931 CCTCAGAAGGATCAATTGTCTGG + Intergenic
986784258 5:11097478-11097500 GCTCTGTAGGAAGAATTGTCAGG + Intronic
990318301 5:54605045-54605067 CCTCTGGTGGAGGAAGTGTGAGG + Intergenic
991306166 5:65178221-65178243 CCTCTGATTGATGAAATGTCAGG - Intronic
992294586 5:75314972-75314994 CCTCCAAAGGAGCAACTGTAAGG + Intergenic
993654749 5:90563888-90563910 TCTCTGAAGGAGCCACTGTATGG + Intronic
994167319 5:96621531-96621553 TGTGTGAAGGAGAAACTGTCAGG + Intronic
997531265 5:134582694-134582716 CCTCTGAGGGAGAAAGTGGCAGG - Exonic
1001884819 5:175279921-175279943 CCTAGGAAGGAGGAAAGGTCAGG + Intergenic
1002135245 5:177103755-177103777 GCTCTGAAGGTGGAAGTGACTGG + Intergenic
1002570092 5:180135281-180135303 GCTCTGAGGGAGGCACTGCCCGG - Intronic
1005348675 6:24913466-24913488 ACTCTGTGGGAGGAACTGTGGGG - Intronic
1006410921 6:33872793-33872815 CTTCTGAAGGAGGAGGCGTCTGG - Intergenic
1007805901 6:44445955-44445977 TCTCTGAAGTTGGTACTGTCAGG + Intronic
1009426859 6:63523785-63523807 CCACTGAAAGAAGAATTGTCTGG - Intronic
1010106998 6:72182141-72182163 GATCTGAAGGTGGAACTGTAAGG - Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1014130102 6:117821172-117821194 TCTCTGAAGGAGGAAGTGTCAGG - Intergenic
1015579435 6:134707455-134707477 GCTCTGTAGGAGGAGCTGTGTGG - Intergenic
1017813508 6:158000891-158000913 CCTCCGTAGGAGGAACCATCTGG + Intronic
1018572759 6:165228104-165228126 CCTCTGAAGACGGAACCCTCAGG + Intergenic
1019929029 7:4211256-4211278 ACTTTGAAAGAGGAAATGTCAGG + Intronic
1020973670 7:14979982-14980004 TCTCAGAAGGGGGAACTGACTGG + Intergenic
1022518827 7:30992763-30992785 CCTCGGGAGGAGGCACTGTGAGG + Intronic
1023497599 7:40815208-40815230 CCCCTGGAGGAGGACCTGCCTGG - Intronic
1023603213 7:41901206-41901228 GCTCTGAAGGAGGAGCTGGAGGG + Intergenic
1024251567 7:47509498-47509520 CCTCTCGGGGAGGAACTGTAAGG + Intronic
1028222370 7:88212812-88212834 CCTCTGAATGAGAAACTCTAGGG + Intronic
1031165010 7:118217228-118217250 ACTTTGAAGGAGGAAGTGTTGGG + Intronic
1033595706 7:142856400-142856422 CCTCAGAAGGAGGACTTGTTTGG + Intronic
1036425680 8:8643297-8643319 ACCCTGAAGAAGGAACTCTCTGG - Intergenic
1037587709 8:20289401-20289423 ACTCTGCAGGAGGAAGTGGCAGG - Intronic
1038169332 8:25114625-25114647 CCTCTGAAGGATGAGGTGTGTGG - Intergenic
1038755163 8:30333782-30333804 CATGTGAAGGAAGAACTGACAGG + Intergenic
1040023547 8:42761635-42761657 CCTATGGAGCAGGACCTGTCTGG + Intronic
1042308565 8:67357427-67357449 CTTCTGAAGGAGTATCTTTCTGG + Intergenic
1042562646 8:70084612-70084634 CCTATGAAGGATGAACTGCCAGG + Intergenic
1044393480 8:91681155-91681177 CCTCTGAATCAGAAACTGTGGGG - Intergenic
1047523783 8:125615563-125615585 GTTCCGAAGGAGGAACTGCCAGG - Intergenic
1048059065 8:130898866-130898888 CCTGTGAAGAATGGACTGTCGGG - Intronic
1049201895 8:141344362-141344384 CTGCTGCAGCAGGAACTGTCGGG - Intergenic
1050171493 9:2824106-2824128 CCTTGGAAGAAGGATCTGTCTGG - Intronic
1050769527 9:9179671-9179693 ACACTTAAGGAGGAACTGGCAGG + Intronic
1053656589 9:40222946-40222968 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1053885040 9:42637271-42637293 CCTCAGGAGGAGGGCCTGTCTGG + Intergenic
1053906944 9:42852168-42852190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054224061 9:62444722-62444744 CCTCAGGAGGAGGGCCTGTCTGG + Intergenic
1054357008 9:64071393-64071415 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054368694 9:64369168-64369190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054528025 9:66153339-66153361 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1056474524 9:86940901-86940923 CCTCTTAAAGAGGAACTGCAGGG - Intergenic
1057740190 9:97704538-97704560 CTTCAGAAGGAGGATTTGTCTGG - Intergenic
1058739964 9:107933145-107933167 ACTCTAAAGGAGAAACTGCCAGG - Intergenic
1059044960 9:110856363-110856385 CCTGTGAAGGAGTAACAGTCAGG - Intergenic
1059849134 9:118317489-118317511 CCTCTGATGGAATAGCTGTCAGG + Intergenic
1060231701 9:121830319-121830341 CCTCTGAATCAGAAACTGTGGGG - Intronic
1061967025 9:134020696-134020718 CCTCTGAAGGAGGAGGGGTTGGG + Intergenic
1203748548 Un_GL000218v1:58132-58154 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1203561172 Un_KI270744v1:59888-59910 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1186346418 X:8697564-8697586 GCTCTGAAGGAGGAGCTGACAGG + Intronic
1186586925 X:10885109-10885131 CCTTTGAAGGATGCTCTGTCAGG - Intergenic
1189223996 X:39397463-39397485 ACTCTGAACGAGGTACTGTCTGG - Intergenic
1192072719 X:67958201-67958223 CCTCTCAAGGAGGAAATGGTTGG + Intergenic
1193202874 X:78712890-78712912 CCTATCAAGGAGTAACTATCAGG + Intergenic
1198097014 X:133389931-133389953 CTTCTGAAGGAAGAACTGCTGGG + Intronic
1198236598 X:134741449-134741471 TCTCTGAGACAGGAACTGTCTGG + Intronic
1200840441 Y:7776222-7776244 CCTCAGAAGAAGGATATGTCCGG - Intergenic
1201161892 Y:11173102-11173124 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic