ID: 1135246024

View in Genome Browser
Species Human (GRCh38)
Location 16:20857792-20857814
Sequence CCTCTGAAGGAGGAACTGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135246016_1135246024 8 Left 1135246016 16:20857761-20857783 CCGTGGGTGATCTTAAAGTTTCC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG 0: 1
1: 0
2: 2
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135246024 Original CRISPR CCTCTGAAGGAGGAACTGTC AGG Exonic