ID: 1135246178

View in Genome Browser
Species Human (GRCh38)
Location 16:20859138-20859160
Sequence TGACAGGTGCAGCATGTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135246178 Original CRISPR TGACAGGTGCAGCATGTTGA TGG Exonic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904028598 1:27520233-27520255 AGGCAGGTGCAGCATGCTGTGGG - Intergenic
904852056 1:33466847-33466869 TGACAGGTCCAACATGTCCAAGG - Intergenic
907103624 1:51860190-51860212 TGAAAGATGAAGCATGCTGATGG - Intronic
911587329 1:99705589-99705611 GGACTGGTGCAGGATGTGGAAGG + Intergenic
912093738 1:106114108-106114130 TGCCATGGGCGGCATGTTGATGG + Intergenic
913364994 1:118027869-118027891 TCATGGGTGCAGCATGTTGCTGG - Intronic
915349895 1:155217751-155217773 TGACAGGGCAAGGATGTTGAGGG + Intergenic
916266691 1:162897188-162897210 TAACAGGTGCAGCATTTTCCAGG - Intergenic
916517058 1:165528292-165528314 TGTCAGGTGCAGCATCTACATGG - Intergenic
918478868 1:184955724-184955746 TGTTAGGTTCAACATGTTGAGGG + Intronic
1063491591 10:6469294-6469316 TAACTGGTGCAGAATTTTGAGGG - Intronic
1065731843 10:28716772-28716794 TGACAGGTGAAGCCTAATGAGGG + Intergenic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1068873195 10:61967591-61967613 TGACAAGTGGAGCTGGTTGATGG + Intronic
1069886434 10:71626840-71626862 TGAGAGGTACAGAATGTTGGAGG - Intronic
1072864279 10:99041894-99041916 TGGTAGCTGCAGCATGTTGGAGG - Intronic
1073600211 10:104839129-104839151 TCACAGGCTCAGCATATTGAAGG - Intronic
1074265327 10:111896551-111896573 AGAGATGTTCAGCATGTTGATGG + Intergenic
1076720418 10:132389952-132389974 TGCCAGGTTCTGCATGTGGAGGG + Intergenic
1077554321 11:3218652-3218674 GGCCAGGTGCAGCAGGTAGATGG + Exonic
1079503992 11:21133447-21133469 TGCCAGGGACAGCAGGTTGATGG - Intronic
1079699051 11:23520675-23520697 TGGCCGGTGCACCAGGTTGAAGG + Intergenic
1079727365 11:23892311-23892333 TGAAAGGTGAAGGAGGTTGAAGG + Intergenic
1081490485 11:43564541-43564563 TGTAAGTTGCAGCATGATGAAGG + Intronic
1081852369 11:46282542-46282564 TGACAGGAACAGCATGTGCAAGG - Intronic
1082024619 11:47563254-47563276 TTACATGTTTAGCATGTTGAGGG - Intronic
1084433712 11:69125999-69126021 GGACAGGTGCAGTTTGATGAGGG - Intergenic
1084919376 11:72456977-72456999 TGGCAGATGCAGAATCTTGATGG - Intergenic
1086538003 11:87872392-87872414 ACCCAGGTGCAGGATGTTGATGG - Intergenic
1087272648 11:96127096-96127118 TGAAAGGTGCAGAGTGTTGATGG + Intronic
1088854175 11:113731824-113731846 TGACAGGTACAGCAATTTGGAGG - Intergenic
1091205650 11:133819071-133819093 AGACAGGTGCAGCAAGAGGAGGG - Intergenic
1091278945 11:134371027-134371049 TGGCAGGTTCTCCATGTTGATGG - Exonic
1091668616 12:2436904-2436926 TGACAAGAGCAACATGCTGAGGG - Intronic
1091906328 12:4192368-4192390 AGGCAGGTATAGCATGTTGAGGG - Intergenic
1092946051 12:13455159-13455181 TCACAGCTACAGCATGCTGAAGG + Intergenic
1095976022 12:47941787-47941809 TGAGAGGTAGAGCATGCTGATGG + Intronic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1100664662 12:96738153-96738175 TGGAAGGTGAAGCCTGTTGATGG + Intronic
1100797012 12:98192963-98192985 TCACAACTGAAGCATGTTGAGGG - Intergenic
1103611409 12:122126444-122126466 TGTCGGGGGCAGCATCTTGAAGG + Intronic
1106936198 13:34723502-34723524 TTACAGGTGGAGCATGTAGCAGG - Intergenic
1107229024 13:38086215-38086237 TGCCATGGACAGCATGTTGATGG + Intergenic
1109118156 13:58417393-58417415 TGATAGGTGCGACCTGTTGATGG + Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1110694233 13:78468817-78468839 TGACAGCTGCAATATGTTAATGG + Intergenic
1111531229 13:89540817-89540839 TCACAGGTGATGCATGCTGAAGG + Intergenic
1113044713 13:106143213-106143235 TAAAAGGTGCACCATCTTGATGG - Intergenic
1113358076 13:109602129-109602151 TGACTAGTTCAGCATGTTAATGG + Intergenic
1115632037 14:35254904-35254926 GAACAGGAGCAGCAAGTTGAAGG - Intronic
1120376445 14:83713804-83713826 TGAGAGAGGTAGCATGTTGATGG + Intergenic
1120386576 14:83853866-83853888 TGACAGGTGCAGCAAATGCAAGG + Intergenic
1122853846 14:104550690-104550712 GGACAGGTGACACATGTTGATGG + Intronic
1202924283 14_KI270724v1_random:9400-9422 TCACAGGTCCAGCATGTCTAGGG - Intergenic
1125042588 15:35208478-35208500 TACCAGGTGCAGCATCTAGAAGG + Intergenic
1126953552 15:53909811-53909833 TGACAGGTGCAATATATTGATGG - Intergenic
1127371805 15:58348486-58348508 TGACAGGTGCAGCCTCTACAGGG + Intronic
1128460070 15:67860183-67860205 TGAGAGGTGCAGCCTGCAGAAGG + Intergenic
1128887581 15:71302828-71302850 CGGCAGGTGCAGCATCTTGGGGG - Intronic
1133168761 16:3967064-3967086 TGACAGCTTCAGGTTGTTGAAGG - Intronic
1135112283 16:19699593-19699615 TGCCAGGTGCCACAGGTTGACGG - Exonic
1135246178 16:20859138-20859160 TGACAGGTGCAGCATGTTGATGG + Exonic
1139138656 16:64234376-64234398 AGCCAGGTGCAGAATGGTGAGGG - Intergenic
1140318377 16:73922173-73922195 TGTCAGGTGCTGTATGGTGATGG - Intergenic
1140330215 16:74049301-74049323 TGACAGGTGCTTCGTATTGAGGG - Intergenic
1141169040 16:81679791-81679813 TGTCAGGTGGAGCGTGTGGATGG - Intronic
1141485768 16:84339361-84339383 TCCCAGGGGCAGCATGATGAAGG - Intergenic
1142814573 17:2415132-2415154 TCAAAGGTGCAGCAGGTTTATGG - Intronic
1147182745 17:38696934-38696956 TGACTGATCCAGCATGCTGAAGG - Intergenic
1147949212 17:44097677-44097699 TGCCGGGAGCAGCAGGTTGACGG - Intronic
1148091239 17:45023662-45023684 GGCCAGGAGCAGCAGGTTGAAGG + Exonic
1148715028 17:49709810-49709832 TTACAGGTGCAGCATTATAAAGG + Intergenic
1148872658 17:50667969-50667991 TAACTGGGGCAGCATGTTGAGGG - Exonic
1149649470 17:58267948-58267970 TGACAGGTCCAGCTTGTCGATGG - Exonic
1150775287 17:68076748-68076770 AGACGGGTTCACCATGTTGATGG - Intergenic
1152346198 17:79753476-79753498 TGACAGCTGCAGCATTTTGGGGG - Intergenic
1152641591 17:81451689-81451711 GGCCAGGTGCTGCAGGTTGAAGG - Exonic
1155980830 18:32177724-32177746 TGACAGCTGCTGCATGTGGTGGG - Intronic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1160336491 18:78044966-78044988 TGCCAGTTTCAGCATCTTGACGG + Intergenic
1162935034 19:13978022-13978044 AGCCAGGTGCAGTATGTGGAGGG - Exonic
1163516176 19:17765248-17765270 TGACAGGCGTGGCATGTTTACGG + Intronic
1164250784 19:23473089-23473111 GCAAAGGTACAGCATGTTGAAGG + Intergenic
1164301931 19:23970360-23970382 AAACAGGCACAGCATGTTGAAGG - Intergenic
1164610954 19:29631398-29631420 TAACAGGTGCAGCCTAATGAGGG + Intergenic
1168459867 19:56545537-56545559 AGTCAGATGCAGCATGGTGAGGG + Intronic
925423097 2:3727450-3727472 TTGCAGCTGCAGCATGTTGAAGG + Intronic
933779687 2:85792817-85792839 TGACAGGTTCATCATGTTTCTGG + Intergenic
940253730 2:151707594-151707616 TGGCAGAAGCAGCAAGTTGAGGG + Intronic
940752285 2:157639470-157639492 GGACAGCTGCAGCAGGGTGATGG - Intergenic
940900220 2:159120004-159120026 TCTCAGGTGCAGCCTGTTGTGGG + Intronic
940914418 2:159238903-159238925 TGGCAGGTGGAGCATGCTGAGGG - Intronic
941239511 2:163018330-163018352 TGACAGATGAAGCAAATTGATGG + Intergenic
942101273 2:172586430-172586452 TGGCAGCTACAGCATGTGGAAGG - Intronic
943223948 2:185144813-185144835 TGCCATGGACAGCATGTTGATGG + Intergenic
945852707 2:215028902-215028924 TGATAGTTTCAGAATGTTGAGGG + Intronic
946948604 2:224848323-224848345 TGACTAGTGCAGCCTGCTGATGG - Intronic
1168949266 20:1785401-1785423 TGACATGTGCAGCTTGTCAAGGG - Intergenic
1169850429 20:10043180-10043202 TGACATCTGCACCATGTTCAAGG - Exonic
1171180966 20:23090129-23090151 TTACATGTGCAGTATGTCGAGGG - Intergenic
1172519119 20:35556043-35556065 TGACAGGTGCTGGATGTAGTGGG - Exonic
1172639955 20:36434909-36434931 TGACATGTGCAGTCTGGTGAGGG + Intronic
1172972519 20:38883710-38883732 TGAGAGGTGCAAGATGTTGATGG + Intronic
1173581543 20:44150400-44150422 TGAAAGGTGCTCCATGTTCATGG + Intronic
1174379882 20:50149629-50149651 TGACAGGTGCAGCAGGGAGGCGG - Intronic
1175719438 20:61276784-61276806 TGAAAAGTGCAGCATCTTGCTGG - Intronic
1180035277 21:45245103-45245125 TGGCAGGTGGAGCATGTGGCTGG + Intergenic
1183290214 22:36997313-36997335 TGCCAGGGGGAGCAGGTTGAGGG - Intronic
949674623 3:6439159-6439181 TGACATGTGCTGCATGTTCATGG + Intergenic
949719660 3:6974214-6974236 CGAAATGTGTAGCATGTTGATGG + Intronic
950391729 3:12702089-12702111 TGGCTGATGCAGAATGTTGATGG + Intergenic
950485728 3:13273154-13273176 AGACAGGTGGTGCATGTGGAGGG + Intergenic
950777775 3:15365266-15365288 TGCCAGGTGGAGGTTGTTGAGGG - Intergenic
954285990 3:49619624-49619646 TGACAGGTGGCTCATGGTGAGGG + Intronic
956814396 3:72894742-72894764 TGCCAGGTGGAGGTTGTTGAGGG + Intronic
961240466 3:125406360-125406382 TGACAGGGGTAGTTTGTTGAGGG + Intergenic
968027115 3:195451687-195451709 TGGCAGGTGCTGGATATTGAAGG - Intergenic
969061902 4:4442650-4442672 TGAGTGGTGGGGCATGTTGATGG + Intronic
970485160 4:16517661-16517683 TGACAGGGACACCATGTTTATGG - Intronic
972148049 4:36053517-36053539 AGAAAAGTGCAGCATCTTGATGG - Intronic
978981385 4:114950481-114950503 TGACAGAGGCAGTATGTTGCTGG - Intronic
981258192 4:142688372-142688394 TAACATGTGCAGAATGATGAAGG - Intronic
982064802 4:151644775-151644797 GAACAGGGGCAGCAGGTTGAGGG - Intronic
984349473 4:178571656-178571678 TGATAGGTGCAGCCTGTAAAAGG - Intergenic
984364311 4:178778455-178778477 TGACATTTAAAGCATGTTGAGGG + Intergenic
985073265 4:186189825-186189847 TGACAGGTGCAGGATGAGGTGGG - Intergenic
986460778 5:7969613-7969635 TGGCAGGTTCAGCATTTTGAAGG + Intergenic
986476179 5:8136012-8136034 AGACAGGTGCACCTTATTGAGGG + Intergenic
989509892 5:42273901-42273923 TGTCAGGTTCAGCATGTTCCAGG + Intergenic
992893563 5:81227093-81227115 TGTCAGGTGCAACAGGTTCAGGG - Exonic
995574516 5:113514631-113514653 TGACCTGTGCAGTCTGTTGAGGG + Intronic
996752109 5:126899250-126899272 TGACAGGTGCAGCAGATTTGGGG - Intronic
999254685 5:150203700-150203722 TGACAGAGGCAGCATGGTCATGG - Exonic
999654434 5:153798412-153798434 TTACAGATTCAGCATGTGGAGGG + Intronic
1002330227 5:178435798-178435820 TGACAGGTCCGGGAAGTTGAGGG - Intronic
1002390473 5:178907919-178907941 TGACAGGTGCAGCATGTTGATGG + Intronic
1003552513 6:7111087-7111109 ACACAGGTACAGCGTGTTGAAGG + Intronic
1006788400 6:36683019-36683041 TGACAGGTGCTGTAGGCTGAGGG - Intronic
1011503624 6:88017620-88017642 TGAATGGTACAGCATGTGGAAGG - Intergenic
1011633497 6:89349831-89349853 TGACATGTGCAGCAGGTGGTGGG - Intronic
1012278437 6:97300678-97300700 TGACAGGGGCAGAAGCTTGAAGG + Intergenic
1013438612 6:110138952-110138974 TGCCATGGACAGCATGTTGATGG - Intronic
1018854244 6:167664029-167664051 TGACAGGTGCAGGATGCTGAGGG + Intergenic
1019452408 7:1106601-1106623 GAACAGGTGCAGCCTGGTGAGGG + Intronic
1020474728 7:8581969-8581991 AGACAGGTGCAGAGTGGTGAGGG + Intronic
1026907239 7:74069420-74069442 TGACAGGTCAACCAGGTTGATGG - Intronic
1027598524 7:80208633-80208655 TGACAGGTGGAGAATGGTCATGG - Intronic
1027757761 7:82236472-82236494 TGTCAAGTGCAACTTGTTGAAGG - Intronic
1030359581 7:108580548-108580570 AGCCAGGTGCAGCATGGTGAGGG - Intergenic
1030634704 7:111935744-111935766 AGTCAGTTGCAGCAGGTTGATGG - Intronic
1031773721 7:125879760-125879782 TGAAAGGAGCTGCATGTTGTGGG + Intergenic
1032279418 7:130489060-130489082 TGACAAGTGCAGGATATTTATGG - Intronic
1034073835 7:148213390-148213412 TGACAGGTGCAGCGTGTCACCGG - Intronic
1034776497 7:153832047-153832069 TGACAGGTGCAGGGTGGTGGGGG + Intergenic
1034928615 7:155142973-155142995 TGAAATGTGCAGAATTTTGAGGG - Intergenic
1035581934 8:746010-746032 TGACGGGGGCAGAGTGTTGAGGG - Intergenic
1037939542 8:22941343-22941365 AGACAGGTGCAGAAGGTTGGAGG + Intronic
1039809051 8:41028348-41028370 TGAGAGGTGCAGGAGGTAGAAGG - Intergenic
1043486282 8:80702089-80702111 TTACTGGGGCAGCATGATGAGGG + Intronic
1048779020 8:137980832-137980854 TGACAGGTGCAGCTGGTGTAGGG - Intergenic
1049031480 8:140041243-140041265 TGCCAGGTACAGTATGTTGATGG - Intronic
1050313671 9:4378976-4378998 TGACAGGTGGAGATTGTTAAGGG + Intergenic
1052135557 9:24905629-24905651 TAGCAGGAGCAGCATGGTGAAGG + Intergenic
1052404576 9:28043407-28043429 TGACAAGTGTAGTATGTAGAAGG + Intronic
1052580643 9:30349936-30349958 TGCCATGGACAGCATGTTGATGG - Intergenic
1053597398 9:39576243-39576265 TCACAGTTGCAGTATGTTGCAGG - Intergenic
1053607892 9:39679388-39679410 GGACAGCTGCAGCATGCTGGAGG - Intergenic
1053855416 9:42333214-42333236 TCACAGTTGCAGTATGTTGCAGG - Intergenic
1053865735 9:42435748-42435770 TGGCAGCTGCAGCATGCTGGAGG - Intergenic
1054245642 9:62663021-62663043 GGACAGCTGCAGCATGCTGGAGG + Intergenic
1054559769 9:66697552-66697574 GGACAGCTGCAGCATGCTGGAGG + Intergenic
1054568866 9:66788756-66788778 TCACAGTTGCAGTATGTTGCAGG + Intergenic
1057997625 9:99833668-99833690 TGACAGGTGCAGCACTGTCAGGG - Intronic
1058731962 9:107859084-107859106 TGCCAGGAGCAGCATATAGATGG + Intergenic
1060912742 9:127363664-127363686 TCACAGGAGCACCATGTTGTGGG - Intronic
1188717401 X:33476866-33476888 GGACAGCTGCAGCATGCTGGAGG - Intergenic
1189006751 X:37003523-37003545 TGGCAGGTGCCGCATGTGGGTGG + Intergenic
1189041828 X:37550132-37550154 TGGCAGGTGCCGCATGTGGGTGG - Intronic
1192230470 X:69261116-69261138 TGCCAGGTACATGATGTTGAAGG - Intergenic
1195965361 X:110425279-110425301 TGGCAGGGGTTGCATGTTGATGG + Intronic