ID: 1135251000

View in Genome Browser
Species Human (GRCh38)
Location 16:20900842-20900864
Sequence CGCGGGCTGCGCGCTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135250993_1135251000 -10 Left 1135250993 16:20900829-20900851 CCTCCCAGCCCGCCGCGGGCTGC 0: 1
1: 0
2: 5
3: 42
4: 383
Right 1135251000 16:20900842-20900864 CGCGGGCTGCGCGCTTCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1135250992_1135251000 -7 Left 1135250992 16:20900826-20900848 CCTCCTCCCAGCCCGCCGCGGGC 0: 1
1: 0
2: 7
3: 100
4: 589
Right 1135251000 16:20900842-20900864 CGCGGGCTGCGCGCTTCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1135250988_1135251000 3 Left 1135250988 16:20900816-20900838 CCTGGCGCCGCCTCCTCCCAGCC 0: 1
1: 0
2: 15
3: 141
4: 925
Right 1135251000 16:20900842-20900864 CGCGGGCTGCGCGCTTCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1135250986_1135251000 21 Left 1135250986 16:20900798-20900820 CCACGGCTCTGCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 56
4: 400
Right 1135251000 16:20900842-20900864 CGCGGGCTGCGCGCTTCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1135250989_1135251000 -4 Left 1135250989 16:20900823-20900845 CCGCCTCCTCCCAGCCCGCCGCG 0: 1
1: 1
2: 8
3: 96
4: 891
Right 1135251000 16:20900842-20900864 CGCGGGCTGCGCGCTTCTGTGGG 0: 1
1: 0
2: 0
3: 0
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135251000 Original CRISPR CGCGGGCTGCGCGCTTCTGT GGG Intronic
900119556 1:1042726-1042748 CTCGGGCTGCGGGCTCCTGGAGG - Intronic
905166027 1:36084018-36084040 CGCGGCCTGGGCGCTTCGCTTGG - Intergenic
914813677 1:151047856-151047878 CGCCGCCGGCGCGCTGCTGTGGG + Exonic
915531515 1:156505001-156505023 CGGGGGCAGGGAGCTTCTGTGGG - Intergenic
923056116 1:230426544-230426566 CCCGGGCTGCGCGTCCCTGTAGG - Intergenic
1084182118 11:67452028-67452050 GGCAGGCTGCGGGCTGCTGTTGG + Exonic
1097218261 12:57430808-57430830 CGGCGGCGGCGCGCTTCTGGGGG + Exonic
1104903952 12:132203726-132203748 GCCGGGCTGCCCGCTTCCGTTGG - Intronic
1106249055 13:27970466-27970488 CGCCGCCTCCGCGCTCCTGTCGG - Exonic
1109113449 13:58352161-58352183 GGAGGCCTGCCCGCTTCTGTAGG - Intergenic
1125744386 15:41988785-41988807 CGTGGGCTGGGGGCTTCTGGGGG + Intronic
1133078643 16:3300329-3300351 CACCGGCTGAGCGTTTCTGTTGG + Exonic
1135251000 16:20900842-20900864 CGCGGGCTGCGCGCTTCTGTGGG + Intronic
1137617050 16:49854857-49854879 CCCGGGGTGCGCGCGTTTGTGGG - Intronic
1141951023 16:87339472-87339494 CACTGGCTGCGCCCTCCTGTGGG - Intronic
1142374878 16:89701678-89701700 CGCGCGCCGCGCGCTTCCGCCGG + Exonic
1143958863 17:10697702-10697724 CGCGGGCTGGGCGGTGCTGCGGG + Intronic
1152226574 17:79095539-79095561 AGCGGGCTGAGCGTATCTGTAGG + Exonic
1152703841 17:81833037-81833059 CGCGGGCCGCGCCCTCCTGCAGG + Intronic
1153935356 18:9915032-9915054 CGAGGGCTGCCCGGTGCTGTTGG + Intronic
1156275810 18:35581771-35581793 CGCGGCCAGCGCGCTACTCTCGG - Intronic
1162246602 19:9406808-9406830 TGCGGGCAGCGAGCTTCGGTGGG - Intergenic
1166420525 19:42632864-42632886 CGGGGACTGAGGGCTTCTGTTGG - Intronic
1168324184 19:55529864-55529886 CGCGGCCGACGCGCTTCTGCGGG - Exonic
925609784 2:5693132-5693154 CGCCGGCCGCGCTCTTCTCTGGG - Exonic
1178561188 21:33641592-33641614 CCAGGGCTGCACGGTTCTGTGGG + Intronic
1183665910 22:39245520-39245542 CGCTGGCTGCCGGGTTCTGTGGG - Intergenic
1185317946 22:50186698-50186720 CTGGGGCTTCGCTCTTCTGTAGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
962272754 3:133990131-133990153 CGCGGGCTCCCCGCTACTGCAGG + Intronic
963236708 3:142963544-142963566 CGCGCGCTCCGCGCTCCTGGCGG - Exonic
990783655 5:59395238-59395260 GGAGGCCTGCGTGCTTCTGTAGG + Intronic
1007633442 6:43285089-43285111 CGCGGGCTGCGCGGCGCTGGGGG - Exonic
1013231373 6:108164816-108164838 AGCGGGCTGTGCGCTCCAGTGGG - Intronic
1019448522 7:1083924-1083946 CACGGCCTGCGTGCTTCTGAAGG + Intronic
1029111755 7:98216308-98216330 TGCAGACTGCGGGCTTCTGTGGG - Exonic
1035475895 7:159144353-159144375 CGCGGGCTGCGCGTTTCACGGGG - Intronic
1036784980 8:11680108-11680130 CGCGGGCTGCGCGCTCTGGGTGG - Intronic
1045549028 8:103153710-103153732 CTCAGGCTGGGAGCTTCTGTTGG + Intronic
1060912274 9:127360711-127360733 CGCTGCCTGCCCGCCTCTGTGGG + Intronic
1062621319 9:137423658-137423680 CGCGGGCTGCGTGCACCTGCTGG + Exonic
1197746062 X:129932666-129932688 TGCGGGCTGCGCGCTGCGCTGGG - Intergenic