ID: 1135252320

View in Genome Browser
Species Human (GRCh38)
Location 16:20911497-20911519
Sequence TCTAACAGGCTCATCAGGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135252320_1135252327 17 Left 1135252320 16:20911497-20911519 CCGATCCTGATGAGCCTGTTAGA No data
Right 1135252327 16:20911537-20911559 GAATGAGGTGTCCAGCTGCCTGG No data
1135252320_1135252324 2 Left 1135252320 16:20911497-20911519 CCGATCCTGATGAGCCTGTTAGA No data
Right 1135252324 16:20911522-20911544 AAAACCCAGAACTCAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135252320 Original CRISPR TCTAACAGGCTCATCAGGAT CGG (reversed) Intronic
No off target data available for this crispr