ID: 1135252329

View in Genome Browser
Species Human (GRCh38)
Location 16:20911555-20911577
Sequence GGTGAGTAAGTAGCAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135252329_1135252335 14 Left 1135252329 16:20911555-20911577 CCTGGCCTTGCTACTTACTCACC No data
Right 1135252335 16:20911592-20911614 TGTCTTCCCACCCTGTCTTCTGG No data
1135252329_1135252338 21 Left 1135252329 16:20911555-20911577 CCTGGCCTTGCTACTTACTCACC No data
Right 1135252338 16:20911599-20911621 CCACCCTGTCTTCTGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135252329 Original CRISPR GGTGAGTAAGTAGCAAGGCC AGG (reversed) Intronic
No off target data available for this crispr