ID: 1135252338

View in Genome Browser
Species Human (GRCh38)
Location 16:20911599-20911621
Sequence CCACCCTGTCTTCTGGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135252331_1135252338 0 Left 1135252331 16:20911576-20911598 CCAAATCTGCCCTCCTTGTCTTC 0: 1
1: 0
2: 3
3: 47
4: 484
Right 1135252338 16:20911599-20911621 CCACCCTGTCTTCTGGTTCAAGG No data
1135252330_1135252338 16 Left 1135252330 16:20911560-20911582 CCTTGCTACTTACTCACCAAATC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1135252338 16:20911599-20911621 CCACCCTGTCTTCTGGTTCAAGG No data
1135252329_1135252338 21 Left 1135252329 16:20911555-20911577 CCTGGCCTTGCTACTTACTCACC No data
Right 1135252338 16:20911599-20911621 CCACCCTGTCTTCTGGTTCAAGG No data
1135252333_1135252338 -10 Left 1135252333 16:20911586-20911608 CCTCCTTGTCTTCCCACCCTGTC No data
Right 1135252338 16:20911599-20911621 CCACCCTGTCTTCTGGTTCAAGG No data
1135252332_1135252338 -9 Left 1135252332 16:20911585-20911607 CCCTCCTTGTCTTCCCACCCTGT No data
Right 1135252338 16:20911599-20911621 CCACCCTGTCTTCTGGTTCAAGG No data
1135252328_1135252338 28 Left 1135252328 16:20911548-20911570 CCAGCTGCCTGGCCTTGCTACTT No data
Right 1135252338 16:20911599-20911621 CCACCCTGTCTTCTGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135252338 Original CRISPR CCACCCTGTCTTCTGGTTCA AGG Intronic
No off target data available for this crispr