ID: 1135253655 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:20922864-20922886 |
| Sequence | CTGGAGACCCAGAAGAAAGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135253652_1135253655 | -1 | Left | 1135253652 | 16:20922842-20922864 | CCTAGGATTTGCCGTCTGCAAGC | No data | ||
| Right | 1135253655 | 16:20922864-20922886 | CTGGAGACCCAGAAGAAAGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135253655 | Original CRISPR | CTGGAGACCCAGAAGAAAGC TGG | Intronic | ||
| No off target data available for this crispr | |||||