ID: 1135253655

View in Genome Browser
Species Human (GRCh38)
Location 16:20922864-20922886
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135253652_1135253655 -1 Left 1135253652 16:20922842-20922864 CCTAGGATTTGCCGTCTGCAAGC No data
Right 1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr