ID: 1135254509

View in Genome Browser
Species Human (GRCh38)
Location 16:20930262-20930284
Sequence CTGGAGTCCTGGGGAAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135254509_1135254516 24 Left 1135254509 16:20930262-20930284 CCATCTCTTCCCCAGGACTCCAG No data
Right 1135254516 16:20930309-20930331 ATAGCATATTGCTCTTTCACAGG No data
1135254509_1135254517 27 Left 1135254509 16:20930262-20930284 CCATCTCTTCCCCAGGACTCCAG No data
Right 1135254517 16:20930312-20930334 GCATATTGCTCTTTCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135254509 Original CRISPR CTGGAGTCCTGGGGAAGAGA TGG (reversed) Intergenic
No off target data available for this crispr