ID: 1135255031

View in Genome Browser
Species Human (GRCh38)
Location 16:20934434-20934456
Sequence GTTCTAAGCACATTTAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135255031_1135255035 -1 Left 1135255031 16:20934434-20934456 CCTCCCTTAAATGTGCTTAGAAC No data
Right 1135255035 16:20934456-20934478 CACTTACATTAGCCTATAGTGGG 0: 29
1: 208
2: 437
3: 465
4: 426
1135255031_1135255036 3 Left 1135255031 16:20934434-20934456 CCTCCCTTAAATGTGCTTAGAAC No data
Right 1135255036 16:20934460-20934482 TACATTAGCCTATAGTGGGCAGG No data
1135255031_1135255034 -2 Left 1135255031 16:20934434-20934456 CCTCCCTTAAATGTGCTTAGAAC No data
Right 1135255034 16:20934455-20934477 ACACTTACATTAGCCTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135255031 Original CRISPR GTTCTAAGCACATTTAAGGG AGG (reversed) Intronic
No off target data available for this crispr