ID: 1135268979

View in Genome Browser
Species Human (GRCh38)
Location 16:21052806-21052828
Sequence GATATCCTAGGGGCCTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135268979_1135268985 0 Left 1135268979 16:21052806-21052828 CCATTTCAGGCCCCTAGGATATC No data
Right 1135268985 16:21052829-21052851 CTAGGAGAATGCAATCAGCGTGG No data
1135268979_1135268988 16 Left 1135268979 16:21052806-21052828 CCATTTCAGGCCCCTAGGATATC No data
Right 1135268988 16:21052845-21052867 AGCGTGGCCTTATATAGCAGGGG No data
1135268979_1135268986 14 Left 1135268979 16:21052806-21052828 CCATTTCAGGCCCCTAGGATATC No data
Right 1135268986 16:21052843-21052865 TCAGCGTGGCCTTATATAGCAGG No data
1135268979_1135268989 20 Left 1135268979 16:21052806-21052828 CCATTTCAGGCCCCTAGGATATC No data
Right 1135268989 16:21052849-21052871 TGGCCTTATATAGCAGGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 130
1135268979_1135268987 15 Left 1135268979 16:21052806-21052828 CCATTTCAGGCCCCTAGGATATC No data
Right 1135268987 16:21052844-21052866 CAGCGTGGCCTTATATAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135268979 Original CRISPR GATATCCTAGGGGCCTGAAA TGG (reversed) Intronic
No off target data available for this crispr