ID: 1135272993

View in Genome Browser
Species Human (GRCh38)
Location 16:21085024-21085046
Sequence TTGCTGTCAGCTGGTGCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135272993_1135272995 -9 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135272995 16:21085038-21085060 TGACAGCAACTCCTCCTCTGCGG No data
1135272993_1135273000 6 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135273000 16:21085053-21085075 CTCTGCGGATCCCTCTGCTGGGG No data
1135272993_1135272999 5 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135272999 16:21085052-21085074 CCTCTGCGGATCCCTCTGCTGGG No data
1135272993_1135273003 29 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135273003 16:21085076-21085098 CGTTTCAAAACCAGAAGTCATGG No data
1135272993_1135272997 4 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135272997 16:21085051-21085073 TCCTCTGCGGATCCCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135272993 Original CRISPR TTGCTGTCAGCTGGTGCTCA CGG (reversed) Intronic