ID: 1135272997

View in Genome Browser
Species Human (GRCh38)
Location 16:21085051-21085073
Sequence TCCTCTGCGGATCCCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135272994_1135272997 -5 Left 1135272994 16:21085033-21085055 CCAGCTGACAGCAACTCCTCCTC No data
Right 1135272997 16:21085051-21085073 TCCTCTGCGGATCCCTCTGCTGG No data
1135272993_1135272997 4 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135272997 16:21085051-21085073 TCCTCTGCGGATCCCTCTGCTGG No data
1135272992_1135272997 5 Left 1135272992 16:21085023-21085045 CCCGTGAGCACCAGCTGACAGCA No data
Right 1135272997 16:21085051-21085073 TCCTCTGCGGATCCCTCTGCTGG No data
1135272990_1135272997 21 Left 1135272990 16:21085007-21085029 CCGTAGAGAGAGGCACCCCGTGA No data
Right 1135272997 16:21085051-21085073 TCCTCTGCGGATCCCTCTGCTGG No data
1135272991_1135272997 6 Left 1135272991 16:21085022-21085044 CCCCGTGAGCACCAGCTGACAGC No data
Right 1135272997 16:21085051-21085073 TCCTCTGCGGATCCCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135272997 Original CRISPR TCCTCTGCGGATCCCTCTGC TGG Intronic