ID: 1135273000

View in Genome Browser
Species Human (GRCh38)
Location 16:21085053-21085075
Sequence CTCTGCGGATCCCTCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135272991_1135273000 8 Left 1135272991 16:21085022-21085044 CCCCGTGAGCACCAGCTGACAGC No data
Right 1135273000 16:21085053-21085075 CTCTGCGGATCCCTCTGCTGGGG No data
1135272992_1135273000 7 Left 1135272992 16:21085023-21085045 CCCGTGAGCACCAGCTGACAGCA No data
Right 1135273000 16:21085053-21085075 CTCTGCGGATCCCTCTGCTGGGG No data
1135272990_1135273000 23 Left 1135272990 16:21085007-21085029 CCGTAGAGAGAGGCACCCCGTGA No data
Right 1135273000 16:21085053-21085075 CTCTGCGGATCCCTCTGCTGGGG No data
1135272994_1135273000 -3 Left 1135272994 16:21085033-21085055 CCAGCTGACAGCAACTCCTCCTC No data
Right 1135273000 16:21085053-21085075 CTCTGCGGATCCCTCTGCTGGGG No data
1135272993_1135273000 6 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135273000 16:21085053-21085075 CTCTGCGGATCCCTCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135273000 Original CRISPR CTCTGCGGATCCCTCTGCTG GGG Intronic