ID: 1135273003

View in Genome Browser
Species Human (GRCh38)
Location 16:21085076-21085098
Sequence CGTTTCAAAACCAGAAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135272993_1135273003 29 Left 1135272993 16:21085024-21085046 CCGTGAGCACCAGCTGACAGCAA No data
Right 1135273003 16:21085076-21085098 CGTTTCAAAACCAGAAGTCATGG No data
1135272996_1135273003 4 Left 1135272996 16:21085049-21085071 CCTCCTCTGCGGATCCCTCTGCT No data
Right 1135273003 16:21085076-21085098 CGTTTCAAAACCAGAAGTCATGG No data
1135272992_1135273003 30 Left 1135272992 16:21085023-21085045 CCCGTGAGCACCAGCTGACAGCA No data
Right 1135273003 16:21085076-21085098 CGTTTCAAAACCAGAAGTCATGG No data
1135272994_1135273003 20 Left 1135272994 16:21085033-21085055 CCAGCTGACAGCAACTCCTCCTC No data
Right 1135273003 16:21085076-21085098 CGTTTCAAAACCAGAAGTCATGG No data
1135273001_1135273003 -10 Left 1135273001 16:21085063-21085085 CCCTCTGCTGGGGCGTTTCAAAA 0: 1
1: 0
2: 2
3: 6
4: 91
Right 1135273003 16:21085076-21085098 CGTTTCAAAACCAGAAGTCATGG No data
1135272998_1135273003 1 Left 1135272998 16:21085052-21085074 CCTCTGCGGATCCCTCTGCTGGG No data
Right 1135273003 16:21085076-21085098 CGTTTCAAAACCAGAAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135273003 Original CRISPR CGTTTCAAAACCAGAAGTCA TGG Intronic