ID: 1135276986

View in Genome Browser
Species Human (GRCh38)
Location 16:21121734-21121756
Sequence CTTGTTAGAAGCACAATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135276980_1135276986 28 Left 1135276980 16:21121683-21121705 CCTCTGCCTCCCGGGTTCAAGTG 0: 6017
1: 36479
2: 85663
3: 127661
4: 131457
Right 1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG 0: 1
1: 0
2: 4
3: 21
4: 203
1135276983_1135276986 18 Left 1135276983 16:21121693-21121715 CCGGGTTCAAGTGATTCTCCTAC 0: 1106
1: 37940
2: 88293
3: 110810
4: 134006
Right 1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG 0: 1
1: 0
2: 4
3: 21
4: 203
1135276982_1135276986 19 Left 1135276982 16:21121692-21121714 CCCGGGTTCAAGTGATTCTCCTA 0: 1184
1: 39305
2: 112874
3: 177587
4: 236080
Right 1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG 0: 1
1: 0
2: 4
3: 21
4: 203
1135276984_1135276986 0 Left 1135276984 16:21121711-21121733 CCTACAAAGCAGCTCTTCGTGCT No data
Right 1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG 0: 1
1: 0
2: 4
3: 21
4: 203
1135276981_1135276986 22 Left 1135276981 16:21121689-21121711 CCTCCCGGGTTCAAGTGATTCTC 0: 14436
1: 78779
2: 141542
3: 187484
4: 155216
Right 1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG 0: 1
1: 0
2: 4
3: 21
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135276986 Original CRISPR CTTGTTAGAAGCACAATTCT GGG Intronic
902747584 1:18483652-18483674 CTTTTTGCAATCACAATTCTAGG + Exonic
902986697 1:20158938-20158960 CCTGCTAGCAGCACAATGCTAGG + Intergenic
905637946 1:39567955-39567977 CTTGTTAGAAATGAAATTCTCGG + Intronic
907829816 1:58054088-58054110 CTTCTTTGCATCACAATTCTAGG + Intronic
908171692 1:61511441-61511463 CTTGAGAGAAGGGCAATTCTTGG - Intergenic
909703448 1:78553047-78553069 CTTTTTAGATGCAGAAATCTTGG + Intergenic
910477883 1:87626338-87626360 TTTGTTAGGTACACAATTCTAGG - Intergenic
910558620 1:88565551-88565573 CTTGTTAGAAGCACATTTGGGGG + Intergenic
911436008 1:97858412-97858434 CTTGATAGGATTACAATTCTAGG + Intronic
912156331 1:106924914-106924936 CTTGTTAGAAATACAAATCCCGG - Intergenic
913479995 1:119279060-119279082 CTTCAAAGAAGCACAATGCTTGG - Intergenic
916096711 1:161357877-161357899 CCTGTCAGAAGCACTACTCTGGG - Intronic
916458412 1:164995105-164995127 CTTATTAGAAGTCCAATTCCTGG + Intergenic
917191900 1:172426882-172426904 TTTGTTAAAACCACCATTCTGGG + Intronic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
921779485 1:219145375-219145397 TTTGGTAGAATCACAATACTTGG - Intergenic
922553258 1:226512953-226512975 TGTGTTAGAAGCACCATTGTTGG + Intergenic
923247503 1:232146777-232146799 CTGGTTAGCAGGACAGTTCTGGG - Intergenic
923287190 1:232507663-232507685 CTTGATAGAAGCACAGTAATAGG - Intronic
1063474917 10:6319868-6319890 CTTGTTAAAGGGACCATTCTTGG + Intergenic
1064002054 10:11671991-11672013 CATTTTATGAGCACAATTCTTGG + Intergenic
1067896763 10:50190205-50190227 TTTGTTTGAAGCTGAATTCTTGG - Intronic
1067952208 10:50751828-50751850 TTTGTTTGAAGCTGAATTCTTGG + Intronic
1068421377 10:56798649-56798671 ATTAAGAGAAGCACAATTCTGGG - Intergenic
1069282981 10:66678606-66678628 CTTCTTAGAAGAACACTTTTGGG + Intronic
1072182676 10:93002459-93002481 CTTGTTAGAAATGCAAATCTTGG + Intronic
1073813065 10:107172286-107172308 CTTCTTTGCAGCATAATTCTTGG + Intergenic
1074608899 10:115002416-115002438 CATGTTTGAAGCACAAAGCTTGG - Intergenic
1076548659 10:131263050-131263072 CAGTTTAGAAGCACAATTGTTGG + Intronic
1080463810 11:32478605-32478627 CTTGTTTGCAGGACTATTCTTGG - Intergenic
1081166008 11:39810001-39810023 CTTGTTTCAAGCACAAAACTGGG + Intergenic
1085557452 11:77437934-77437956 CTTGGAAGCAGCACAAGTCTGGG - Intronic
1085767499 11:79295808-79295830 CTTATTAAAAGCCCATTTCTAGG + Intronic
1085780926 11:79408292-79408314 CTTGTTAGAAATGCAAATCTTGG - Intronic
1085957383 11:81415634-81415656 CTTTTGAGAAGCACAGATCTAGG + Intergenic
1087438689 11:98155778-98155800 CTTGATAGAAGAACAAATTTGGG - Intergenic
1087497024 11:98904602-98904624 CGTGTTACAAGCATAATTGTTGG - Intergenic
1089000889 11:115051298-115051320 ATTGTTAGAAAAACAATACTTGG - Intergenic
1089787609 11:120919477-120919499 CTTGTCAGAATCCCAATTCTGGG + Intronic
1093505480 12:19860354-19860376 CTAAGTAAAAGCACAATTCTTGG + Intergenic
1097483677 12:60165360-60165382 CTTGTAAGCAGCATAAATCTGGG - Intergenic
1098079590 12:66769946-66769968 CTTGTTTGAAGGACAACTGTTGG + Intronic
1101053697 12:100890401-100890423 CTTCCTAGAAGTAGAATTCTTGG + Intronic
1102822434 12:115919112-115919134 CTTGTTAAAAACACATTTATAGG - Intergenic
1107153392 13:37138686-37138708 CTTGGTAGACTTACAATTCTTGG - Intergenic
1108318367 13:49260999-49261021 GTTGTAAGAAGCAAAGTTCTAGG + Intronic
1109151537 13:58854173-58854195 ATTGTTAGAAGCACATTGCTTGG - Intergenic
1113419853 13:110162668-110162690 ATTTTTATAAGCACAGTTCTCGG + Intronic
1113545919 13:111150317-111150339 GCTGTGAGAAGGACAATTCTTGG + Intronic
1113843730 13:113374485-113374507 CTTGTTCCAACCACAACTCTGGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115440230 14:33425926-33425948 CTTGTTTGAAACACACTGCTAGG - Intronic
1116030135 14:39561204-39561226 GTGTATAGAAGCACAATTCTTGG - Intergenic
1116901361 14:50365118-50365140 CTAGTTAGAGCCACATTTCTGGG - Intronic
1118588099 14:67375810-67375832 CTTTTGAGAAGCACTTTTCTGGG + Intronic
1118919123 14:70133737-70133759 TCTGATAGAAGCACAATTCTGGG + Intronic
1118970898 14:70636738-70636760 CTTGTTAGAAACATAATCTTGGG + Intergenic
1119976869 14:79034445-79034467 TTTGTGAGAAGAACAATTTTGGG + Intronic
1122757624 14:103995205-103995227 CTGGTTAGAAGCCATATTCTAGG + Intronic
1124406990 15:29402103-29402125 ATTCTTAGAAGTAGAATTCTAGG - Intronic
1126339064 15:47619645-47619667 CTTGTTAAAAACAGACTTCTGGG - Intronic
1126891526 15:53210258-53210280 CATATTATAAGCACAATCCTAGG + Intergenic
1127366469 15:58295122-58295144 CTTGTTGGAGACACAATGCTTGG + Intronic
1127522775 15:59759587-59759609 GCTGTTAGCATCACAATTCTTGG + Intergenic
1129001083 15:72334670-72334692 TTTGCTAGAAACAGAATTCTAGG + Intronic
1129629423 15:77242185-77242207 ATTGTTAGAAGTACATTTTTTGG + Intronic
1131702426 15:94953170-94953192 TTTGTTAGGGCCACAATTCTAGG + Intergenic
1133329453 16:4963293-4963315 CTCTTTAGAAGCAAAATTCGTGG - Intronic
1134902770 16:17953565-17953587 CTTGTTAAAAGCAGATTCCTGGG - Intergenic
1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG + Intronic
1137809216 16:51336807-51336829 CATGTTACAGGCACTATTCTAGG - Intergenic
1138616008 16:58167657-58167679 CTTGTTAGCAGAGCTATTCTGGG - Intronic
1139165670 16:64562548-64562570 CTTGTTAGTAGTAAAAATCTGGG - Intergenic
1140045424 16:71437518-71437540 CTTGTTAGAAACACAGTCTTGGG - Intergenic
1140376879 16:74451831-74451853 CTTTATAGAAGCAATATTCTTGG - Intergenic
1140524716 16:75613007-75613029 CTTGTTAAAAACACACTGCTGGG - Intronic
1140756757 16:78074549-78074571 CTTGTTAGAAATGCAATTCTGGG - Intergenic
1144003295 17:11075526-11075548 CCTGAAAGAAGCACAAATCTTGG - Intergenic
1144940341 17:18934849-18934871 TTTGTTAAAAACACCATTCTTGG - Intergenic
1144992075 17:19239930-19239952 CTTATCAGAATCCCAATTCTTGG - Intronic
1145297027 17:21600130-21600152 CTTGTTAGAAGCTTAACCCTGGG + Intergenic
1145366932 17:22272772-22272794 CTTGTTAGAAGCTTAACCCTGGG - Intergenic
1146089765 17:29864904-29864926 CTTGTGAAAAACACATTTCTGGG - Intronic
1149590291 17:57824114-57824136 CTTGTTTGAATCAAAATTCCTGG + Intergenic
1150047370 17:61926969-61926991 CTAGTTAGAGGCACAATCCAAGG + Intronic
1153154541 18:2133588-2133610 CTTGTTAGAAATACAAATCCGGG + Intergenic
1153330999 18:3874506-3874528 CTTTTAAAAAGCAGAATTCTTGG - Intronic
1153552264 18:6273927-6273949 CTTGTTAGAAACGCAAATGTGGG + Intronic
1153682126 18:7510824-7510846 ATTGTGGGAAGCACAATCCTTGG + Intergenic
1155535149 18:26809298-26809320 CGTTTTAGAAAGACAATTCTGGG + Intergenic
1157395851 18:47340170-47340192 CTTGTAAGAGGCACACCTCTGGG - Intergenic
1159330864 18:66992281-66992303 CTTGCTCCAAGGACAATTCTGGG + Intergenic
1159563101 18:70016802-70016824 CTAGTTGCAGGCACAATTCTAGG + Intronic
1160551669 18:79697338-79697360 CTTGTTAGGAGCTCCACTCTGGG + Intronic
1163825969 19:19525216-19525238 CCTGTTAGAAGCCCAAGTCAGGG - Intronic
1166038792 19:40190100-40190122 CTTGTAAGAGGCAAAATTCTGGG - Intergenic
925764959 2:7223936-7223958 CTTGTTACAAACACTTTTCTAGG + Intergenic
927175836 2:20406735-20406757 CTTGCTAGAAGCAACACTCTAGG - Intergenic
928196785 2:29221964-29221986 CATATTAGAAGCACAATTACTGG + Intronic
928754912 2:34512352-34512374 CTTGTAAGAACCACATTCCTGGG + Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930828573 2:55718881-55718903 CTTGTTAGAATGCAAATTCTTGG + Intergenic
932125035 2:69137507-69137529 TTTGAGAGAAGCACAATTATAGG + Intronic
932265508 2:70364194-70364216 CTTGTTAGAAACAGAATCTTGGG - Intergenic
933069728 2:77842217-77842239 CTTGTTAAAAACAGATTTCTGGG + Intergenic
938215328 2:129507820-129507842 CTTGTAAGAGGCAAAATTCCAGG + Intergenic
938783940 2:134608815-134608837 CTTTTCACCAGCACAATTCTCGG - Intronic
940278416 2:151963709-151963731 CTTCTTAGAAGCAAAATTACTGG - Intronic
943131760 2:183862585-183862607 CCAGCTAGAAGCACAATTATGGG - Intergenic
944676984 2:202041855-202041877 CTCGTTAGATGCACATCTCTTGG - Intergenic
947279560 2:228434752-228434774 TCTGTTACAAGCAGAATTCTAGG + Intergenic
948519708 2:238528146-238528168 TCTGTTGGGAGCACAATTCTGGG - Intergenic
1171988524 20:31677739-31677761 CTTGGTAGAAGCACCAGTGTGGG - Intronic
1172024725 20:31940495-31940517 CTTGTTAGAAATACAATCTTAGG - Intronic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1173475466 20:43356113-43356135 TTTGTTAAAAACGCAATTCTAGG + Intergenic
1175031727 20:55961446-55961468 CTTGTTGGATGCAGAATTATTGG - Intergenic
1177367893 21:20161354-20161376 CTTGTCAGAAACAAATTTCTGGG + Intergenic
1178009064 21:28261642-28261664 TTTGTTAGATGCCAAATTCTTGG - Intergenic
1181391648 22:22587645-22587667 CTTTTTAGAAGCACCATTAATGG + Intergenic
1181445868 22:22973756-22973778 GTTATTAGAAGCATCATTCTGGG + Intergenic
950316701 3:12007369-12007391 CATATTAGAAGAGCAATTCTGGG - Intronic
951967287 3:28400664-28400686 TTTGCTGGAAGCAAAATTCTTGG - Intronic
952226577 3:31382858-31382880 CTTGATAGAATTATAATTCTTGG - Intergenic
953144565 3:40262525-40262547 CTTGTTTGAACCACAAATTTTGG - Intergenic
953520617 3:43639190-43639212 GTTGTTAGAAGCACATCACTAGG + Intronic
953807718 3:46085831-46085853 CTTGTTAGAAATGCAGTTCTGGG + Intergenic
954463244 3:50639542-50639564 CATTTTAGAAGCACTTTTCTTGG + Intronic
956636520 3:71370750-71370772 CTTGTTACAAGCACATTGCTAGG + Intronic
957965014 3:87311080-87311102 TTTGTTGGAAACAAAATTCTTGG - Intergenic
958034298 3:88151553-88151575 CTTGTTAGAAGCAGAATTTCTGG - Intronic
959368147 3:105489277-105489299 CTTGTTAGAAATAAAAATCTCGG - Intronic
959990275 3:112623539-112623561 CTTGTTAAAATTACAATTCTTGG + Intronic
960803990 3:121565095-121565117 CTGGTAACAAGCACTATTCTGGG - Intergenic
962250163 3:133831234-133831256 CTTGTTAAAAACACACATCTGGG - Intronic
963239390 3:142988137-142988159 TTTGTTAGAAGCAAATTCCTGGG + Intronic
964211477 3:154233129-154233151 CTGGTAAGAAACCCAATTCTAGG - Intronic
964723305 3:159789561-159789583 CTTGTTTGAAACACAATTGCTGG + Intronic
965772634 3:172196880-172196902 CTTTTTTAAAGAACAATTCTTGG + Intronic
966275541 3:178161428-178161450 TTTGTTAGACACAGAATTCTAGG - Intergenic
967435021 3:189433536-189433558 CTTGCTAGATACAAAATTCTTGG - Intergenic
967744593 3:193041070-193041092 CTTCTTAGAAGCTCAATTAGGGG - Intergenic
967903792 3:194485125-194485147 CTTGTTAGAACAACAATGCCTGG - Intronic
972051885 4:34745411-34745433 CTTATTAGATGCACAAATCTAGG - Intergenic
972308929 4:37861219-37861241 TTTGTAAGAAACACAATTTTTGG - Intronic
972503245 4:39697388-39697410 CTTGTTAGAAGCGCAGTCTTAGG + Intergenic
977501034 4:97837227-97837249 GATCTTAGAAGCAGAATTCTAGG + Intronic
979117955 4:116851382-116851404 CATTTTAGAAGAATAATTCTGGG - Intergenic
979636386 4:122959066-122959088 CTTGTTAGAAATGCAAATCTGGG - Intronic
979712518 4:123796903-123796925 TTTGCTGGAGGCACAATTCTTGG + Intergenic
981358275 4:143817841-143817863 TTTGTTAGATACAAAATTCTAGG + Intergenic
981369526 4:143943960-143943982 TTTGTTAGATACAAAATTCTAGG + Intergenic
982047653 4:151464903-151464925 CTTGTTAGAATACAAATTCTTGG + Intronic
982967000 4:161922577-161922599 CTTGTTAGAAATATAAGTCTTGG - Intronic
984136453 4:175946359-175946381 CTTGTGTGAAGCACTGTTCTAGG + Intronic
984688826 4:182702186-182702208 CTGGTTAGATGCACAATTCCTGG - Intronic
985816009 5:2128575-2128597 GTTTTTAGAAGCAGAATTTTGGG + Intergenic
986875766 5:12106769-12106791 CAGGTTAAAAGCAGAATTCTGGG + Intergenic
988789650 5:34595572-34595594 CTTGTTAGAGAGACATTTCTTGG + Intergenic
992001572 5:72441474-72441496 GTGGTTACAAGCACAACTCTGGG - Intergenic
992120211 5:73584940-73584962 CTTTTTAGAAGAAATATTCTAGG - Intergenic
992175201 5:74143116-74143138 CTTGTTAGATATGCAATTCTTGG + Intergenic
992223786 5:74598675-74598697 CTTTTTAGAAGCAAAATTCTTGG - Intergenic
992420402 5:76598153-76598175 CTTGTTATATGCTGAATTCTTGG - Intronic
994207393 5:97050689-97050711 ATAGTTAGAAGCACAATTCTGGG + Intergenic
994251985 5:97546813-97546835 CATGCTAAAAGCACAATTATAGG + Intergenic
995555318 5:113322131-113322153 CTTGTTAGAAATACAAATCATGG - Intronic
995645852 5:114310518-114310540 TTTCTTAGAAACACAGTTCTGGG + Intergenic
995812111 5:116119305-116119327 CTTATTACAAACACAATTCAGGG - Intronic
998727450 5:145033979-145034001 CTTGTTAGATGCAAATTTCTTGG + Intergenic
999065481 5:148681066-148681088 CTTATTTGAAGCACAGTTTTTGG - Intergenic
999557571 5:152762083-152762105 TTTGTTAACAGCACAATTTTTGG - Intergenic
999589531 5:153129883-153129905 CTAGTTTGAGGCATAATTCTGGG + Intergenic
1000670031 5:164049934-164049956 CTTGTAAAAAACACAATTCTTGG - Intergenic
1001571000 5:172730457-172730479 CTTGTTAAATGCAGAATCCTGGG - Intergenic
1002053243 5:176583876-176583898 CTTTCTAGAAGCACAGTTCTGGG - Intronic
1002938721 6:1697623-1697645 CTTGTTAGAAAAACAAATTTGGG + Intronic
1003274215 6:4634872-4634894 ATTCTTAGAAGCAAAATTGTTGG - Intergenic
1004068100 6:12270217-12270239 CTTTTCAGAAGAACAATTATTGG + Intergenic
1004558337 6:16721848-16721870 CTTTTGAGAAACAGAATTCTTGG + Intronic
1008001041 6:46360099-46360121 CTTGTTAAAATGAAAATTCTAGG + Intronic
1008959721 6:57254127-57254149 CTTGTTAGAAATGAAATTCTAGG - Intergenic
1011537999 6:88398248-88398270 CTTGTTAGAAGGAAAATTTATGG - Intergenic
1013976387 6:116083658-116083680 CTTGTTAGAAACAAATTTTTGGG - Intergenic
1021614152 7:22485868-22485890 CCTGTTAGAAATACAGTTCTTGG - Intronic
1023053911 7:36276728-36276750 CTTGTTAGAAGTACAAACCTTGG + Intronic
1023237195 7:38101981-38102003 CTTGTTAGAAATGCAATTCCTGG + Intergenic
1023593211 7:41800670-41800692 CTTTTTGGAAACAAAATTCTTGG - Intergenic
1026571031 7:71530866-71530888 CTTGTTAAAAATAAAATTCTTGG - Intronic
1026601377 7:71780341-71780363 CTTGTTAGAAAAACAATTACTGG + Exonic
1026637310 7:72095730-72095752 CTTGGTAAAAGGAAAATTCTGGG + Intronic
1027769009 7:82382727-82382749 CTTTTCAGAAGCACCATTTTAGG - Intronic
1031919409 7:127589780-127589802 CTCTTTAGAAGCAGGATTCTGGG + Intronic
1032646819 7:133834099-133834121 CTTATTTGAAGCAGAATTGTGGG + Intronic
1034727962 7:153357894-153357916 GTTGAGAGAAGCACAATTATGGG - Intergenic
1035334278 7:158115641-158115663 CTTGGTGGAGGCACACTTCTGGG - Intronic
1039130172 8:34254924-34254946 CTTTCTAGACCCACAATTCTAGG - Intergenic
1040930749 8:52732649-52732671 ATCGATAGAAGCACAAATCTCGG + Intronic
1040957910 8:52998329-52998351 ATATTTAGCAGCACAATTCTAGG - Intergenic
1042440746 8:68822985-68823007 CATTTTAGAAAGACAATTCTTGG + Intergenic
1045140204 8:99272001-99272023 CTTGTTAAATGCAGAATTCTGGG + Intronic
1046062889 8:109159992-109160014 CTTGTTAGAAATGCAATTCTTGG - Intergenic
1050363766 9:4855275-4855297 CTTTTCAGAAGAACCATTCTAGG - Intronic
1051577245 9:18630762-18630784 TTTGTCAGAAGCAGAAGTCTTGG + Intronic
1055202958 9:73690046-73690068 ATTGTTATAAGCACAATGTTTGG - Intergenic
1055447560 9:76397786-76397808 GTTCTTAGAAGTACAACTCTTGG - Intergenic
1056892956 9:90513397-90513419 GAGGTTAGAAGCAAAATTCTGGG + Intergenic
1056998781 9:91488400-91488422 CTTGTTGGAAGCATCATTCTAGG + Intergenic
1057328411 9:94088714-94088736 ATTGTTAGAAGTAGAATTCCTGG - Intronic
1059294966 9:113262195-113262217 CTTGGTATAAGCACAGTTGTTGG - Exonic
1060463729 9:123883512-123883534 CTTGTTAGAAATACAATTCTTGG - Intronic
1060580951 9:124746112-124746134 CTTATTAGAAACACAATTCTGGG + Intronic
1060712679 9:125885123-125885145 CTTGATACCAGCACAACTCTTGG + Intronic
1061175282 9:128991870-128991892 CTTGATAAAAGCAGAATTCCTGG + Intronic
1187170264 X:16844168-16844190 CTTGTTAGGAGTACATTTCTTGG + Exonic
1187398072 X:18935170-18935192 ATGGTTAGAAGAAGAATTCTTGG - Intronic
1188179042 X:27031220-27031242 CTTGTCAGAAGCACAATGCCTGG - Intergenic
1189104225 X:38220328-38220350 CATGTGAGAGGCAAAATTCTGGG + Intronic
1189252799 X:39614124-39614146 CTTGTTAGAAATGCAAATCTCGG + Intergenic
1189350349 X:40271145-40271167 CTTGTTAGAAACACAGATGTTGG + Intergenic
1189629120 X:42933318-42933340 CTTTTTAAAAGCAAAAGTCTAGG + Intergenic
1190431684 X:50384101-50384123 CTTGTTAAGAGCACAATCTTAGG - Intronic
1192526583 X:71850836-71850858 CTTGTTAGGAGTACATTTCTTGG - Intergenic
1195372378 X:104190021-104190043 CTTGTTAAAAAAACAATGCTAGG - Exonic
1198658678 X:138942653-138942675 GTTGTTAGAGGTAAAATTCTGGG - Intronic
1199041638 X:143121312-143121334 CATGTGAGAAGGACATTTCTGGG + Intergenic
1200071161 X:153530156-153530178 CTTGTTTGAATGAGAATTCTGGG + Intronic
1201711116 Y:16993573-16993595 CCTGTTAAAAGCACTATTTTAGG + Intergenic
1201728018 Y:17175090-17175112 CTTGTTTAAATCACAATTGTTGG + Intergenic