ID: 1135283356

View in Genome Browser
Species Human (GRCh38)
Location 16:21172031-21172053
Sequence ATTTATACACACTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135283356_1135283360 24 Left 1135283356 16:21172031-21172053 CCCAGCTCCAAGTGTGTATAAAT No data
Right 1135283360 16:21172078-21172100 ACTTTGGATCTTTTGAGACCAGG No data
1135283356_1135283359 8 Left 1135283356 16:21172031-21172053 CCCAGCTCCAAGTGTGTATAAAT No data
Right 1135283359 16:21172062-21172084 CTTTATCAAAATACAGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135283356 Original CRISPR ATTTATACACACTTGGAGCT GGG (reversed) Intronic
No off target data available for this crispr