ID: 1135283458

View in Genome Browser
Species Human (GRCh38)
Location 16:21172869-21172891
Sequence CCTCCCTGAAACCATCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135283450_1135283458 15 Left 1135283450 16:21172831-21172853 CCTGTTGATGTTCTCTTCCTTCC No data
Right 1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG No data
1135283454_1135283458 -6 Left 1135283454 16:21172852-21172874 CCAGCCTTTTCAGGGTCCCTCCC No data
Right 1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG No data
1135283453_1135283458 -2 Left 1135283453 16:21172848-21172870 CCTTCCAGCCTTTTCAGGGTCCC No data
Right 1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG No data
1135283455_1135283458 -10 Left 1135283455 16:21172856-21172878 CCTTTTCAGGGTCCCTCCCTGAA No data
Right 1135283458 16:21172869-21172891 CCTCCCTGAAACCATCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135283458 Original CRISPR CCTCCCTGAAACCATCACTG TGG Intronic
No off target data available for this crispr