ID: 1135284048

View in Genome Browser
Species Human (GRCh38)
Location 16:21178229-21178251
Sequence CCTGAGCTGCAGGCCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135284048_1135284056 -5 Left 1135284048 16:21178229-21178251 CCTTCCAGGGCCTGCAGCTCAGG No data
Right 1135284056 16:21178247-21178269 TCAGGAGAAGTAGGGGCCCTGGG No data
1135284048_1135284055 -6 Left 1135284048 16:21178229-21178251 CCTTCCAGGGCCTGCAGCTCAGG No data
Right 1135284055 16:21178246-21178268 CTCAGGAGAAGTAGGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135284048 Original CRISPR CCTGAGCTGCAGGCCCTGGA AGG (reversed) Intronic
No off target data available for this crispr