ID: 1135284259

View in Genome Browser
Species Human (GRCh38)
Location 16:21179859-21179881
Sequence ACCGTTGGACATAAGCCCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135284259_1135284265 29 Left 1135284259 16:21179859-21179881 CCTCAGGGCTTATGTCCAACGGT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1135284265 16:21179911-21179933 GTTTTTTGTTTTCAGAAATGAGG 0: 1
1: 1
2: 33
3: 460
4: 3897
1135284259_1135284266 30 Left 1135284259 16:21179859-21179881 CCTCAGGGCTTATGTCCAACGGT 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1135284266 16:21179912-21179934 TTTTTTGTTTTCAGAAATGAGGG 0: 1
1: 5
2: 20
3: 323
4: 4053

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135284259 Original CRISPR ACCGTTGGACATAAGCCCTG AGG (reversed) Exonic
916020794 1:160790428-160790450 GCTGTTGGACATCAGGCCTGTGG + Intergenic
919577599 1:199331070-199331092 ACTGTTGGAGGTAGGCCCTGGGG - Intergenic
1070796941 10:79222393-79222415 ACCGTTGGAAACCAGCCCTGTGG + Intronic
1075691009 10:124394151-124394173 ACCACTGGACATAGGCCCTGAGG + Intergenic
1086507667 11:87522839-87522861 ACGGTTTAAAATAAGCCCTGGGG + Intergenic
1088334982 11:108693916-108693938 ACCTTGGAACATAACCCCTGAGG - Intronic
1094734879 12:33223087-33223109 ACTGTCGGACCTGAGCCCTGCGG - Intergenic
1095696915 12:45154269-45154291 ACAGTTGGATATAAGCACAGGGG + Intergenic
1097911629 12:64976321-64976343 GCAGTTGGACATTAGCCTTGTGG + Intergenic
1103905559 12:124325672-124325694 ACTGTTGGACAGAAACGCTGAGG - Intronic
1118308691 14:64676752-64676774 TCCCTAGGACACAAGCCCTGTGG + Intergenic
1121618709 14:95331621-95331643 TCAGTTGGTCACAAGCCCTGTGG + Intergenic
1122244115 14:100389531-100389553 GCCGGGGGACAGAAGCCCTGAGG + Intronic
1133107120 16:3519236-3519258 ACAGTTGGACAGAGGCCCTTGGG - Intronic
1135284259 16:21179859-21179881 ACCGTTGGACATAAGCCCTGAGG - Exonic
1142905665 17:3039963-3039985 ATTGTTTGCCATAAGCCCTGTGG - Intergenic
1143034549 17:3986996-3987018 ATCGTTAGCCATAAGCCCCGTGG + Intergenic
1143476067 17:7204670-7204692 CCCGGTGGACATGATCCCTGGGG - Intronic
1148172554 17:45534906-45534928 ACCGGTGAGCATAAACCCTGGGG + Intergenic
1148276716 17:46310544-46310566 ACCGGTGAGCATAAACCCTGGGG - Intronic
1148298833 17:46528132-46528154 ACCGGTGAGCATAAACCCTGGGG - Intronic
1148363365 17:47032629-47032651 ACCGGTGAGCATAAACCCTGGGG - Intronic
1150403758 17:64881829-64881851 ACCGGTGAGCATAAACCCTGGGG + Intronic
1152496491 17:80676462-80676484 ACCTCTGGACATCAGCGCTGTGG + Intronic
1155190564 18:23425802-23425824 ACCTTTGGACATAAGGCCAAAGG + Intronic
1155424716 18:25695040-25695062 ACATTTGGATATAAGGCCTGTGG + Intergenic
929105764 2:38364306-38364328 AATGTTGGACATCAACCCTGAGG + Intronic
929905899 2:46046297-46046319 GCCGTTGGATATAGGCTCTGGGG + Intronic
933399051 2:81767948-81767970 ACTTTAGGACATAAGCCTTGTGG - Intergenic
936083599 2:109451937-109451959 ACCTCTGGACATAAGCTCAGAGG - Intronic
943961180 2:194265085-194265107 AGGGTTGGGGATAAGCCCTGGGG + Intergenic
948002242 2:234577759-234577781 ACTGCTGGACATCAGCCCTGTGG + Intergenic
1181616637 22:24059494-24059516 AGTCTTGGACCTAAGCCCTGTGG + Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961543547 3:127617010-127617032 GCCGCTGGACATACGCCGTGAGG - Exonic
976111469 4:81678838-81678860 ACCGTTCGGCATCAGTCCTGAGG + Intronic
984975262 4:185224804-185224826 TCCTTTGGACATAACCCTTGTGG + Intronic
985576261 5:674815-674837 AGCGGCTGACATAAGCCCTGTGG + Intronic
990816767 5:59794526-59794548 TCAGTGGAACATAAGCCCTGAGG - Intronic
998276008 5:140753870-140753892 ACTGTTGGACATGAGCTCTCAGG - Intergenic
1003606917 6:7570615-7570637 ACTGTTGGACACAGGCACTGCGG - Intronic
1013637421 6:112042172-112042194 AACTTTGGACATAAAACCTGAGG + Intergenic
1018274243 6:162113484-162113506 CCTGTTGGAAATAAGCACTGTGG + Intronic
1022939529 7:35219885-35219907 AAGTTTGGACATAAGCCCAGTGG - Intronic
1024526605 7:50354742-50354764 ACCGTTGGTTACAGGCCCTGTGG + Intronic
1027930490 7:84527698-84527720 AGAGTTTGACATAAGCTCTGTGG - Intergenic
1046283733 8:112068207-112068229 ACAGGTGGATATATGCCCTGAGG + Intergenic
1046964249 8:120145574-120145596 ACCGTTGCACTCCAGCCCTGGGG + Intronic
1050029602 9:1371695-1371717 ACCTTGGGACATCAGCTCTGTGG + Intergenic
1052640799 9:31164395-31164417 ACGGCTGGGCATATGCCCTGGGG + Intergenic
1190988555 X:55522382-55522404 ACCACTGGACACAAGCTCTGAGG - Intergenic