ID: 1135285168

View in Genome Browser
Species Human (GRCh38)
Location 16:21187137-21187159
Sequence TACCTCCCATTTTAGAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135285166_1135285168 -8 Left 1135285166 16:21187122-21187144 CCAGTGCGTCCTCACTACCTCCC No data
Right 1135285168 16:21187137-21187159 TACCTCCCATTTTAGAGATAAGG No data
1135285165_1135285168 15 Left 1135285165 16:21187099-21187121 CCAATACACAGCAATACATGTTT No data
Right 1135285168 16:21187137-21187159 TACCTCCCATTTTAGAGATAAGG No data
1135285164_1135285168 16 Left 1135285164 16:21187098-21187120 CCCAATACACAGCAATACATGTT No data
Right 1135285168 16:21187137-21187159 TACCTCCCATTTTAGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135285168 Original CRISPR TACCTCCCATTTTAGAGATA AGG Intergenic
No off target data available for this crispr