ID: 1135285231

View in Genome Browser
Species Human (GRCh38)
Location 16:21187572-21187594
Sequence CTAGATCAGCAGTTCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135285228_1135285231 18 Left 1135285228 16:21187531-21187553 CCCCGTCTCAAAAATAAAACTAA No data
Right 1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG No data
1135285229_1135285231 17 Left 1135285229 16:21187532-21187554 CCCGTCTCAAAAATAAAACTAAC No data
Right 1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG No data
1135285230_1135285231 16 Left 1135285230 16:21187533-21187555 CCGTCTCAAAAATAAAACTAACT No data
Right 1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135285231 Original CRISPR CTAGATCAGCAGTTCTCAGT TGG Intergenic
No off target data available for this crispr