ID: 1135286907

View in Genome Browser
Species Human (GRCh38)
Location 16:21201337-21201359
Sequence CTGGGTAACCTGATAGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135286898_1135286907 22 Left 1135286898 16:21201292-21201314 CCCAAGAGGGTTTATTCCCATTA 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG 0: 1
1: 0
2: 0
3: 10
4: 90
1135286902_1135286907 5 Left 1135286902 16:21201309-21201331 CCATTACTGGCAAGTTTTGATGG 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG 0: 1
1: 0
2: 0
3: 10
4: 90
1135286901_1135286907 6 Left 1135286901 16:21201308-21201330 CCCATTACTGGCAAGTTTTGATG 0: 1
1: 0
2: 1
3: 14
4: 139
Right 1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG 0: 1
1: 0
2: 0
3: 10
4: 90
1135286899_1135286907 21 Left 1135286899 16:21201293-21201315 CCAAGAGGGTTTATTCCCATTAC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135286907 Original CRISPR CTGGGTAACCTGATAGTACA GGG Intronic
900530680 1:3151488-3151510 CTGGGAAGCCTGTTAGTAAAAGG - Intronic
901753305 1:11425347-11425369 CTGGGTCTCCTGATAGGTCAGGG + Intergenic
907249074 1:53125918-53125940 CTGGGCTTCCTGCTAGTACAGGG + Intronic
909054734 1:70807364-70807386 CTGGGTTCCCTGAGAGCACAGGG + Intergenic
909864927 1:80655376-80655398 ATGGGTAACCTGCTAATAAAGGG + Intergenic
910073172 1:83243877-83243899 CAGTGTAACCTGTTTGTACAAGG + Intergenic
912680580 1:111726545-111726567 CTGGGGAACCTGATGCTCCAGGG + Exonic
915729558 1:158043516-158043538 CTGGGAACACTGATAGTTCAGGG + Intronic
919733891 1:200932428-200932450 CTGGGCAACCTAATGGTTCAAGG + Intergenic
1074050262 10:109875180-109875202 CTGGGGCAGCTGAGAGTACAGGG + Intronic
1075275580 10:121089774-121089796 CTTGGTAACCTGCTAGGAGATGG - Intergenic
1088774278 11:113067272-113067294 CTGGAAAACCGGATAGTAAAAGG - Intronic
1092201654 12:6588103-6588125 TTGGGTAACATGATAATAGAGGG - Intronic
1093416842 12:18929830-18929852 CTGGATACCCTGATAGGACAGGG + Intergenic
1095889179 12:47220032-47220054 CTTGGTCACCTGGGAGTACAGGG - Intronic
1097093187 12:56523972-56523994 CTGGGTAACCTGAGAGAACTAGG - Intronic
1101225639 12:102685645-102685667 CTGGGTAAACTGATTGTTCATGG + Intergenic
1103360973 12:120353371-120353393 CTGGGTAACCTGATGGGGCAAGG + Exonic
1107899282 13:44995992-44996014 CTGGGTACCCTGCTAGTATTGGG - Intronic
1111129039 13:83950446-83950468 CTGAGTAACCTGCCAGTACCTGG - Intergenic
1115315372 14:32019741-32019763 CTGAGTCATCTCATAGTACATGG + Intergenic
1116933977 14:50718272-50718294 CTAGATAACCTGTTAGTACCTGG + Intergenic
1121780508 14:96619016-96619038 CTGGGAAAGCTGATAGGTCATGG + Intergenic
1126716322 15:51521836-51521858 GTGCATAACCTTATAGTACATGG - Intronic
1131031893 15:89193457-89193479 CTGTGTAGCCTGATAGTCCTCGG + Intronic
1132103080 15:99041525-99041547 CTGGGTAACCAGATAGCAGTTGG + Intergenic
1133173969 16:3999672-3999694 CTGGGTAACCTGAGATTCCCTGG + Intronic
1134691988 16:16197230-16197252 CTGGGTACCCTAATAGCACATGG + Intronic
1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG + Intronic
1139633450 16:68244546-68244568 CTGGGGAACCAGAGAGGACATGG - Intergenic
1144334034 17:14253129-14253151 CTGGGTTCCCTGTTCGTACAAGG - Intergenic
1147663204 17:42128682-42128704 CTGGGCCCCCCGATAGTACATGG + Exonic
1148106733 17:45122864-45122886 CTGGGTAAACGGAGAGTCCATGG + Intronic
1151235593 17:72717602-72717624 CTGGGTACCCTTATAAAACAAGG - Intronic
1152172432 17:78761373-78761395 CTTGGGAACGTGATAATACAGGG + Intronic
1155067406 18:22279737-22279759 CTGAGTAACCTGTGCGTACAAGG + Intergenic
1156712274 18:39961474-39961496 CTGTGTGACCTGAAAATACAAGG - Intergenic
1158816620 18:61105512-61105534 CTCCGTAACATGAAAGTACAAGG - Intergenic
1159168840 18:64736592-64736614 CTGGGTAACTTGATGGCTCATGG - Intergenic
1163661651 19:18581594-18581616 TTGGGTAGCCTGATGGCACAGGG - Intronic
1167758482 19:51427940-51427962 CTGGGTTACCTGTTTGTATAAGG - Intergenic
927721357 2:25384690-25384712 CTGGGTAGCTTGAGAGGACAGGG + Intronic
930946550 2:57083663-57083685 CTGGGGAACATGATGGTACCTGG + Intergenic
936016094 2:108960105-108960127 CTGGGTCCACTGATAGTACAGGG + Intronic
936242109 2:110796724-110796746 CTGGCTACCCTGATAAGACAAGG + Intronic
939282133 2:140077703-140077725 CTGGGAAAGCTGATAGCCCAAGG + Intergenic
939891902 2:147746516-147746538 CTGGGTTCCCTGATGGTACATGG - Intergenic
942329446 2:174806535-174806557 CTGGCTCACTTGATAGAACAGGG - Intronic
946146101 2:217732175-217732197 ATGGGTGACCTGACAATACAGGG + Intronic
1176671629 21:9740234-9740256 CAGAGTCACCTGCTAGTACATGG + Intergenic
1178492283 21:33060338-33060360 CTTGGTAACCTGATATTGCTAGG + Intergenic
1180207880 21:46273463-46273485 CTGGGTCACCAGGTAGTCCATGG + Exonic
1181108879 22:20590058-20590080 CTGGGGACCCTGACAGGACACGG - Intergenic
949134994 3:553944-553966 CTGGGTATCCTGTTGGTCCAAGG - Intergenic
957332938 3:78789669-78789691 CTGGTTAACTTGAGAGAACACGG + Intronic
963206556 3:142642218-142642240 TTTGGAAACCTGATAGTATATGG + Intronic
963884454 3:150565441-150565463 CTAGGTAACCAAATAGTAGAAGG - Intronic
967307291 3:188071331-188071353 TTGGGTTACTTGATAGTACCAGG - Intergenic
971830867 4:31692906-31692928 CTCTGTAACATGAAAGTACAAGG + Intergenic
977114086 4:92999398-92999420 CTGGGAAACCTGTTAGTCCTTGG + Intronic
985403112 4:189611593-189611615 CAGAGTCACCTGCTAGTACATGG - Intergenic
987748574 5:22009196-22009218 CTGGGAAGCCTGAAAGAACATGG - Intronic
990187399 5:53223061-53223083 TTGGGTATCCTGATGGCACAGGG + Intergenic
991215891 5:64157118-64157140 CTGGGGAAACTCATAGAACAAGG + Intergenic
991235146 5:64385202-64385224 CTGGGTAACCTGAAATTACCTGG + Intergenic
991768754 5:70018994-70019016 CTGGGAAGCCTGAAAGAACATGG - Intergenic
991847992 5:70894071-70894093 CTGGGAAGCCTGAAAGAACATGG - Intergenic
993296163 5:86143991-86144013 ATGTGTAACCTGAAAGTACAGGG - Intergenic
1003303770 6:4908263-4908285 CTGGTTAACCTGATGGGAAAGGG + Intronic
1003349031 6:5298333-5298355 CTGGGAAGCCTGGTTGTACATGG + Intronic
1013700652 6:112765699-112765721 TAGGGTAACATGATAGGACAGGG - Intergenic
1014020057 6:116576541-116576563 CTGGGGAGCCAGATAGAACAGGG - Intronic
1015910450 6:138163492-138163514 CTGGGTAACATGATAAAGCAGGG + Intronic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1021735101 7:23635271-23635293 CTGGGTGAGCTGAGAGTAAAAGG + Intronic
1021812716 7:24418974-24418996 CTGGCTAAGCTGATATAACAAGG + Intergenic
1023086462 7:36574427-36574449 CTAGGACACCTGATAGTAAATGG - Intronic
1023561306 7:41475832-41475854 CTGGGTAAACTGATATTTTAGGG - Intergenic
1024486942 7:49929999-49930021 CAGGGTTACCTGATACTATAAGG - Intronic
1027290848 7:76708753-76708775 CAGTGTAACCTGTTTGTACAAGG + Intergenic
1027367158 7:77470257-77470279 CTGAGTAAGATTATAGTACAGGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1039005822 8:33035850-33035872 CCAGGTAACCTGACAGAACATGG + Intergenic
1039608210 8:38900291-38900313 CTGGGTACCCAGTTAGTAAACGG - Intergenic
1041048732 8:53912776-53912798 CAGGGTAACCTAATAGTTTAAGG - Intronic
1041223826 8:55678237-55678259 CAGGGTGGCCTGATACTACAAGG - Intergenic
1041321314 8:56616546-56616568 ATGGGTAAGCTGAAAGTAAAAGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1047844400 8:128790250-128790272 CAGGGTAACTTGGTAGTAAATGG - Intergenic
1053777776 9:41565924-41565946 CTGGTTAAATTGATACTACATGG + Intergenic
1058880417 9:109280914-109280936 CTGGGTAACCTAAGAGTAGACGG + Intronic
1059936427 9:119315973-119315995 CTCTGTAACATGAAAGTACAAGG + Intronic
1060664434 9:125424325-125424347 CTGGGCAACCTGTGAGGACAAGG - Intergenic
1188125311 X:26360587-26360609 GTGTGTAACCTGATATTAAAGGG + Intergenic
1193676982 X:84466699-84466721 CTGGGAAACCTGAGAATGCAAGG - Intronic
1195583292 X:106532564-106532586 CTGGGTTCCCTGGTTGTACAGGG - Intergenic
1197445409 X:126547424-126547446 CTGGGTTACCTAATAATACTTGG + Intergenic
1198441152 X:136664460-136664482 TTGAGTAACTTGCTAGTACATGG - Intergenic
1198994410 X:142557881-142557903 CAGGCTAACCTGATAAAACAAGG - Intergenic
1200250115 X:154548263-154548285 ATGGGGAACCCGATGGTACAGGG + Intronic
1201942894 Y:19478713-19478735 CTGGGTTTCCTGGTACTACATGG - Intergenic