ID: 1135288096

View in Genome Browser
Species Human (GRCh38)
Location 16:21211343-21211365
Sequence TGGAGTTCCCTGAAGTCACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135288091_1135288096 26 Left 1135288091 16:21211294-21211316 CCAAGAGACATACCTGGAAAGGC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG 0: 1
1: 0
2: 1
3: 20
4: 208
1135288089_1135288096 27 Left 1135288089 16:21211293-21211315 CCCAAGAGACATACCTGGAAAGG 0: 1
1: 0
2: 0
3: 20
4: 234
Right 1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG 0: 1
1: 0
2: 1
3: 20
4: 208
1135288095_1135288096 -5 Left 1135288095 16:21211325-21211347 CCAACTGAGAAACATCTATGGAG 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG 0: 1
1: 0
2: 1
3: 20
4: 208
1135288093_1135288096 14 Left 1135288093 16:21211306-21211328 CCTGGAAAGGCAGGATTTACCAA 0: 1
1: 1
2: 2
3: 19
4: 224
Right 1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG 0: 1
1: 0
2: 1
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135288096 Original CRISPR TGGAGTTCCCTGAAGTCACA AGG Exonic
900093887 1:932571-932593 TGGTGGTCCCTGAACCCACACGG + Intronic
900555618 1:3278943-3278965 TGGAGATCCGTGGAGCCACACGG + Intronic
900643613 1:3698764-3698786 TGGAGTCATCTGAAGTCACCTGG + Intronic
901853996 1:12032386-12032408 TGGAAGTCCCTGGGGTCACATGG + Intergenic
902137308 1:14320543-14320565 TGGAGGTCTCAGAATTCACAGGG - Intergenic
902830291 1:19008035-19008057 TGGATTTCCCTGTCGTCACGAGG + Intergenic
903402711 1:23068244-23068266 TGGTGCTAACTGAAGTCACATGG - Intronic
904895797 1:33817180-33817202 TGGGCTTCCCTGAAGGCCCAGGG - Intronic
908060799 1:60346571-60346593 TGGTGTTCCATGAAGAAACAAGG + Intergenic
910309423 1:85806868-85806890 TGAAGTCCCCTGTAGTCACAAGG + Intronic
911580565 1:99628911-99628933 GTGACTTGCCTGAAGTCACACGG - Intergenic
915215685 1:154339286-154339308 TGGATTTTCCTGAGGTCACATGG - Intronic
915617349 1:157049301-157049323 TAGAGTTCCCTGAAGTTAGTTGG + Intergenic
915849642 1:159307547-159307569 TGGTGCTCCCTGGAGCCACAGGG - Intronic
916176780 1:162047231-162047253 TGGAGTTCAATGAAGTCACAGGG - Intergenic
916569778 1:166014977-166014999 TAGACTTCTCTGAAGTCACTGGG + Intergenic
918546247 1:185687683-185687705 TGGACTTTCCTGAAGTCAAGAGG + Intergenic
921275104 1:213511476-213511498 TGGAGTTCCCTGAAGCAAGTGGG + Intergenic
921995267 1:221411190-221411212 ATGTGTTACCTGAAGTCACAGGG + Intergenic
922705764 1:227789296-227789318 TGGGCTGCCCTGAAGTCACTGGG - Intergenic
1063135343 10:3211747-3211769 TAGATTTTTCTGAAGTCACATGG + Intergenic
1063191272 10:3697057-3697079 AGGAGCTCCATGAAGGCACAGGG - Intergenic
1064931317 10:20631023-20631045 TGGAGTGCCCTTAACTCAAAGGG - Intergenic
1068036951 10:51771757-51771779 TGGAGTTGCCTGAAGTGCTAGGG - Intronic
1069028663 10:63571817-63571839 TGAATTTACCTGGAGTCACATGG + Intronic
1070533193 10:77355359-77355381 TTGATTTCCCTGAAGCCACATGG - Intronic
1072316978 10:94212664-94212686 TAGAATTTCCTGAAGTCATATGG + Intronic
1072436716 10:95420903-95420925 AGGTGTTCCCCGAACTCACAAGG - Intronic
1073349580 10:102810249-102810271 TGCAGTTCCCTGAAGCCACTGGG + Intronic
1075925068 10:126245090-126245112 TGGAGTCACCTGAAGGCACCAGG + Intronic
1076332362 10:129679456-129679478 TGCGGGTCCCTGGAGTCACATGG - Intronic
1076495642 10:130895921-130895943 TGGAGCACCCTCAAGTCTCAGGG + Intergenic
1077198578 11:1293757-1293779 TGGAGTGCCCTGCGGTCACCAGG + Intronic
1077476666 11:2793677-2793699 TGGAGGGACCAGAAGTCACAAGG + Intronic
1078080199 11:8198602-8198624 TGGAGGGCACTGAAGTCTCAAGG - Intergenic
1079764891 11:24380115-24380137 TAGATCTCCCTGGAGTCACAAGG + Intergenic
1080026983 11:27625590-27625612 TGCAGCTCCCAGAAGTCCCAGGG - Intergenic
1080250234 11:30225747-30225769 TGGGGTTCCCAGAAGCCAGAAGG + Intergenic
1081524851 11:43920395-43920417 TCCACTTCACTGAAGTCACAAGG - Intergenic
1081658426 11:44873249-44873271 TGAAATTCCCTGAACTAACATGG - Intronic
1086162637 11:83739804-83739826 TGGAGTTCCTTGGATTCTCATGG + Intronic
1086438823 11:86807843-86807865 TGGAGTTCCCTTATGACACTGGG - Exonic
1086815802 11:91368920-91368942 GGGACTTGCCTGAAGTCACCAGG - Intergenic
1088921595 11:114263199-114263221 TAGATTTCTCTGAAGTCTCAAGG + Intronic
1089331369 11:117691240-117691262 TGGACCTCCCTGAAAACACAAGG + Intronic
1089673595 11:120073957-120073979 GGGACTTCCCTGAAGTCTCAGGG - Intergenic
1090447470 11:126776296-126776318 TGGAGTTTGCTGAAGTGCCATGG + Intronic
1090744106 11:129693132-129693154 GGGACTTGCCTGGAGTCACACGG + Intergenic
1092246204 12:6865828-6865850 TGAAGCTCCCTTAAGGCACATGG + Intronic
1092892931 12:12986207-12986229 TGGAGGGCCCTGCAGTCACCTGG + Intronic
1094232982 12:28129139-28129161 TGTAATTCCATGAAGTCAAAAGG + Intergenic
1095820283 12:46470985-46471007 TGGAGCTCACCGAAGTCAGAGGG - Intergenic
1098103707 12:67046291-67046313 TGGATCTTCCTGAGGTCACATGG - Intergenic
1101397230 12:104359060-104359082 CAGAGTTCCTTGAAGTCACCTGG - Intergenic
1101414312 12:104495936-104495958 TGGAGTTCCTTGAAGTGCCCAGG + Intronic
1101842562 12:108339067-108339089 TCGAGTGGCCTGCAGTCACAGGG - Exonic
1105686354 13:22786161-22786183 AGGAGATCCCTGAAATCAGAAGG + Intergenic
1105758994 13:23495758-23495780 TTGAGATCTCTGAAGTTACATGG - Intergenic
1109122481 13:58475382-58475404 TGGATATCCCAGATGTCACAAGG + Intergenic
1110339715 13:74375188-74375210 TAGAGGTCCCTGGAGGCACATGG - Intergenic
1114146763 14:19986063-19986085 TGGAGTGCCCTGAAGCCTCCAGG - Intergenic
1114316518 14:21514840-21514862 TGGACTTCCATGAAGGCCCAGGG - Intergenic
1120851425 14:89175626-89175648 GGCACTTCCCTGAGGTCACACGG + Intronic
1121505601 14:94474409-94474431 GAGACTTACCTGAAGTCACATGG - Intronic
1121629788 14:95413705-95413727 TGGAGTTCCCTGCAGGGACCGGG - Intronic
1122423743 14:101593442-101593464 GTGAATTCCCTGAAGTCTCAGGG + Intergenic
1122827226 14:104376201-104376223 GGCAGCTCCCTGAAGGCACACGG - Intergenic
1122922387 14:104885382-104885404 TGGAGTCCCCTGAACTCTCCAGG + Exonic
1123042693 14:105496854-105496876 AGGGGGTCCCTGAAGTTACAGGG + Intronic
1123479733 15:20620026-20620048 TGGTGCTCCCTGAATCCACATGG + Intergenic
1123638273 15:22380338-22380360 TGGTGCTCCCTGAATCCACATGG - Intergenic
1125539409 15:40461254-40461276 GTGACTTGCCTGAAGTCACATGG + Intronic
1129928966 15:79392956-79392978 TGGGGATCCCTGAAGCCAGAAGG - Intronic
1130012513 15:80162771-80162793 AGTAGTTCTCTGATGTCACAAGG + Intronic
1132286693 15:100668714-100668736 GGGAGTTGCCTGAAGTCATATGG + Intergenic
1134074222 16:11279400-11279422 CCCAGTTCCCTGAAGTGACAGGG - Intronic
1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG + Exonic
1137597356 16:49733776-49733798 GGGACTTCCCTGAAGACCCAAGG + Intronic
1137776786 16:51061719-51061741 TGGAGTTCCAAGAAATTACAAGG + Intergenic
1138234920 16:55374048-55374070 TGGAGTCCTGTGAATTCACAGGG + Intergenic
1140318954 16:73929114-73929136 CAGAGTTGCCTAAAGTCACATGG + Intergenic
1142140438 16:88470376-88470398 TGGGGTTCCATGAGGTCACCTGG - Intronic
1143444818 17:7001423-7001445 TGGAGTGCCCTGATGTCAGGTGG - Intronic
1145309427 17:21693244-21693266 GCGAATTTCCTGAAGTCACAGGG - Intronic
1148594391 17:48841306-48841328 TGGACTTTCCTAAAGTCATAGGG + Intronic
1149382411 17:56107225-56107247 TTGAGTTGCCTGAAGTCCCAAGG + Intergenic
1150848497 17:68682748-68682770 TGGAATTATCAGAAGTCACAAGG - Intergenic
1152526517 17:80891068-80891090 TGGAGATCCTAGAAGTCACTGGG - Intronic
1152817342 17:82415803-82415825 TGGAGATCCCTGAAGGGAAAGGG - Intronic
1154463886 18:14623635-14623657 TGGAGTGCCCTGAAGCCTCCAGG - Intergenic
1155070660 18:22313164-22313186 TGGGGTTCCCTGATTTCCCATGG + Intergenic
1155550895 18:26963735-26963757 TTGAATTGCCTGAAGTCACATGG - Intronic
1155979570 18:32166304-32166326 TGGAGAGCTCTGAAGTCACATGG + Intronic
1158338953 18:56444944-56444966 TGAAGATACCTAAAGTCACATGG + Intergenic
1158819011 18:61136563-61136585 TGGAGTCGGCTGAAGACACATGG - Intergenic
1161394080 19:4035441-4035463 ACGAGTTCCCTGAGGCCACAAGG - Intronic
1161719385 19:5894718-5894740 TGGAGGTCCCGGCAGGCACAGGG + Intronic
1162147235 19:8620419-8620441 TGCAGGTCCCTGAGGCCACATGG + Intergenic
1163639484 19:18453401-18453423 TGCATTTCCCTGATGACACATGG - Intronic
1165604481 19:37089380-37089402 TAGAGTTCCCTGATTTCATAAGG + Intronic
1166774567 19:45304550-45304572 TGAAGTTCCCTGAACTTCCATGG - Intronic
928128819 2:28634416-28634438 TGGAATCCCCTGAGGTCTCAGGG - Intronic
929682914 2:44009593-44009615 TGGAACTTCCTGAATTCACAAGG - Intergenic
930222264 2:48756520-48756542 GTGGCTTCCCTGAAGTCACACGG + Intronic
930478963 2:51922973-51922995 TGGAATTCCCTGAAGTATTAAGG + Intergenic
931819904 2:65941362-65941384 TAAGGTTGCCTGAAGTCACATGG + Intergenic
932474632 2:71995010-71995032 GAGCCTTCCCTGAAGTCACATGG + Intergenic
932534340 2:72576502-72576524 AGGATTTGCTTGAAGTCACAAGG + Intronic
933991429 2:87636942-87636964 TGGAGTTGCCAGCAATCACACGG + Intergenic
935803445 2:106723238-106723260 TCGGCTCCCCTGAAGTCACATGG - Intergenic
936302414 2:111313880-111313902 TGGAGTTGCCAGCAATCACACGG - Intergenic
937117339 2:119417478-119417500 TGGAGTTCCCTTATGTGACTAGG + Intergenic
941314354 2:163973910-163973932 TGGAAATCCCTCAAGTCTCAAGG - Intergenic
941362346 2:164566883-164566905 TGGATTTGCCCAAAGTCACAGGG + Intronic
941468345 2:165856180-165856202 TGGACTGCAATGAAGTCACAAGG - Intergenic
941740867 2:169033683-169033705 TGGAGTGCCATGAGCTCACAGGG + Intergenic
945865737 2:215172905-215172927 AGGAGTTCCATGTAGTCACTAGG + Intergenic
947748056 2:232519642-232519664 TGGAGTCCTCTGGAGTCTCATGG - Intergenic
947893039 2:233643370-233643392 TGGTGTTCCCTTAAGGCCCAAGG + Intronic
948625761 2:239266930-239266952 TGGAGGTCCCCTAAGCCACAGGG + Intronic
1169421179 20:5462008-5462030 TGGAGTTCCTGAAAGTGACAGGG - Intergenic
1170503990 20:17004966-17004988 TGTACTCCCCCGAAGTCACAAGG - Intergenic
1171410181 20:24941439-24941461 TGGTATTCCCTGAAGCCACAAGG - Intergenic
1172430927 20:34890977-34890999 TGGAGTTCACTTCAGTGACATGG - Intronic
1174336662 20:49866728-49866750 TGGAGTAAACTGAAGTCTCAAGG - Intronic
1175808154 20:61842480-61842502 AGGAATTTCCTGAAGTCATACGG + Intronic
1175839504 20:62018072-62018094 TGTACCTGCCTGAAGTCACATGG - Intronic
1176016256 20:62934824-62934846 AGGCGCTCCCTGAAGCCACAGGG - Intronic
1176810645 21:13534738-13534760 TGGAGTGCCCTGAAGCCTCCAGG + Intergenic
1177863086 21:26478396-26478418 TGCTGTTCCATGAACTCACAAGG - Intronic
1178095664 21:29212463-29212485 TGGAGTTTCCTGGACTTACAGGG - Intronic
1178121329 21:29473316-29473338 GGGAGTTCCCTGATGTCACTAGG + Intronic
1178718977 21:34991635-34991657 GTGACTTGCCTGAAGTCACACGG + Intronic
1179600493 21:42474404-42474426 GTGAGTTCCCTGCAGTGACAGGG - Intronic
1181316742 22:21975433-21975455 TGGGGTTCCCATAAGGCACAAGG - Intronic
1181507224 22:23367806-23367828 TGGCGTTCCCTTAACTCACCTGG + Intergenic
1181773920 22:25146219-25146241 TCGAGTTGCCCAAAGTCACACGG + Intronic
1182113612 22:27742250-27742272 TGGTGGTCCCTGAGGTGACAGGG - Intergenic
1184208762 22:43023082-43023104 TGGAACTCACTGCAGTCACATGG + Intergenic
1184607747 22:45583915-45583937 AGGAGTTCCCTGAGGTCATGCGG + Intronic
950298374 3:11851766-11851788 TTGATGTGCCTGAAGTCACAGGG + Intergenic
952259444 3:31725741-31725763 TGGAACTCCCGGAAGCCACAGGG + Intronic
952838152 3:37621925-37621947 TGGAGTTCTTTGAATTCACCTGG + Intronic
954243303 3:49310995-49311017 TGGTCTTCCCTAAAGTCACCTGG - Intronic
955148281 3:56341789-56341811 TGGTGATCCCTGAAAACACAGGG + Intronic
955240143 3:57170527-57170549 TGGAGTTGCCCAAAGCCACATGG - Intergenic
956910810 3:73815013-73815035 TAGAGTCCACTGAAGGCACAGGG + Intergenic
959096172 3:101958508-101958530 TAGAGCTCCCTGAAGTCTCAAGG - Intergenic
959344565 3:105177182-105177204 TCCTGTTCCCTGAAGACACAGGG - Intergenic
959586976 3:108034073-108034095 TGGCATGCCCTGAAGACACAAGG - Intergenic
960036481 3:113107552-113107574 TGTAGTTTGCTGAAGTCCCAGGG - Intergenic
961345668 3:126261722-126261744 TGGAGGTCCCTGAACTGACTGGG - Intergenic
961414893 3:126750036-126750058 TTGAGGTCCCTGAAGGCACCAGG - Intronic
963880057 3:150519018-150519040 TGGCATTCCCTGAAGCCACAAGG - Intergenic
964814731 3:160704600-160704622 TGGGGTTCCCTGATGTCAGTGGG + Intergenic
965087570 3:164118601-164118623 TGGAGTTCCCTAAAAGCACCTGG - Intergenic
965975304 3:174613601-174613623 TGATGTTCCCTGAAGTCCCTGGG + Intronic
968483132 4:845646-845668 TGGAGCTCCCTGGGGGCACAGGG + Intergenic
969925103 4:10577990-10578012 TGGGTTTGCCTGAGGTCACATGG - Intronic
971028644 4:22612669-22612691 GGAAATTGCCTGAAGTCACATGG - Intergenic
971044695 4:22792337-22792359 TGGATTTCCCTGTCTTCACATGG - Intergenic
971312223 4:25535327-25535349 TGGAATTCACTGAGGTGACATGG - Intergenic
971620520 4:28849276-28849298 GGGAGTTCCCTGGAGTCAACAGG - Intergenic
977144812 4:93425475-93425497 TTGAGTTCCTTTAAGTCAGAAGG - Intronic
978922400 4:114200523-114200545 TGGTGTTCCTTCAAGTCCCAAGG + Intergenic
980619334 4:135278181-135278203 TGGAGTTCACTGGAGTCTTAAGG - Intergenic
982133688 4:152252518-152252540 TGCAATTCCCTGACGACACATGG + Intergenic
983656081 4:170086344-170086366 TGGAGTTCCCGGAACCCAGAAGG + Intronic
984622761 4:181972682-181972704 AGGAGTTCCCTGCAATCACTGGG - Intergenic
986102143 5:4622866-4622888 TGGAGGTCACTTAAGTCAGAGGG - Intergenic
988133977 5:27144778-27144800 TGAAGTTCCCTAAGGTGACATGG + Intergenic
988584838 5:32499401-32499423 TGGGGTTTATTGAAGTCACAGGG - Intergenic
988935593 5:36079441-36079463 TGGAGTATGCTGAAGTCTCACGG + Intergenic
993704722 5:91156664-91156686 TAGAGTTCCCTGAACTCACTAGG + Intronic
997998336 5:138604381-138604403 TGGTGTTCCCTGTAGTCATGAGG + Intergenic
998431043 5:142070173-142070195 TGCAGTTCCTGCAAGTCACATGG + Intergenic
1001901683 5:175436110-175436132 TGCAGTTCCCTAGAGTGACATGG - Intergenic
1002460286 5:179369878-179369900 TGGAGTCATCTGGAGTCACACGG + Intergenic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1005630622 6:27704138-27704160 TGGAATTCCCTGCTGTCAAATGG - Intergenic
1006967537 6:38003844-38003866 AGGGGTTCCCTGAAGGCAGAAGG - Intronic
1007909928 6:45503403-45503425 TGGTGATACCTGATGTCACATGG - Intronic
1008312204 6:49990041-49990063 TGAAGTTCCCTTAAGGCCCAAGG - Intergenic
1008516372 6:52323229-52323251 TGGAGATCTCTAAACTCACAGGG + Intergenic
1008640543 6:53458118-53458140 TGGGGTTCACTCAGGTCACATGG - Intergenic
1009032060 6:58071440-58071462 TCAATTTCCCTGATGTCACACGG + Intergenic
1009207882 6:60825891-60825913 TCAATTTCCCTGATGTCACACGG + Intergenic
1012190815 6:96277377-96277399 TGGTGTTCCCTCAAGGCCCAAGG - Intergenic
1012424121 6:99095618-99095640 TGGAGGGCCCTGAATTCTCAGGG + Intergenic
1012761658 6:103310074-103310096 TGATGTTCCCTGAAGGCCCAAGG - Intergenic
1016135251 6:140532737-140532759 TGGTGTTCCCTTAAGGCCCAGGG - Intergenic
1016530043 6:145049356-145049378 TGGAGTTCACTGAAGAAAAAGGG - Intergenic
1016686907 6:146892060-146892082 GGGAGTTCCCTGGAGGGACAGGG + Intergenic
1016707780 6:147133043-147133065 GTGACTTGCCTGAAGTCACACGG + Intergenic
1017971072 6:159313440-159313462 TGAAGCTCCCTGCAGTCACAGGG - Intergenic
1018486401 6:164244995-164245017 TGGGCTTTCCTGAAGTGACAAGG - Intergenic
1018963097 6:168462562-168462584 TGGAATTCCCAGATGTCTCATGG + Intronic
1024400247 7:48916417-48916439 TGTAGTACATTGAAGTCACATGG + Intergenic
1028053325 7:86210876-86210898 AAGAGTTCCCTCAAGTCACTGGG - Intergenic
1029291707 7:99506581-99506603 TGGAGTGGCAGGAAGTCACAGGG - Intronic
1032430077 7:131853803-131853825 TGGAGAACCCAGAAGTGACATGG + Intergenic
1032498383 7:132380140-132380162 TGTAGTTCCCGGAAGCCCCAAGG - Intronic
1032714667 7:134496939-134496961 TGGAGTTTCCAGAGGCCACATGG + Intergenic
1032978993 7:137259824-137259846 TTGAGTTCGCTGAAGTCAAGAGG + Intronic
1034925633 7:155119158-155119180 TGGAGTTCACAGTAGACACAGGG + Intergenic
1035635353 8:1139905-1139927 GGGATTTCCCTGAGGTCACACGG + Intergenic
1039282068 8:35997017-35997039 TGATGTTCCCTTAAGTCTCAAGG + Intergenic
1039742759 8:40397402-40397424 TGGGGGTTCCTGCAGTCACAGGG + Intergenic
1040518065 8:48150608-48150630 TGGTGAGCCCTGCAGTCACATGG + Intergenic
1042489044 8:69378262-69378284 TGTAGCTCCCTGGGGTCACATGG + Intergenic
1048011225 8:130457891-130457913 TGGAGATCCCTGAAATAACTGGG - Intergenic
1048315489 8:133358829-133358851 GGGAGTTGCTTGAAGTCACAAGG - Intergenic
1048954665 8:139525931-139525953 TGGTGTAGCCTGAAGTCCCAGGG + Intergenic
1051000712 9:12278856-12278878 TGGAGTTTCCTGTAGTAATAAGG - Intergenic
1055158282 9:73092424-73092446 AGCAGTTCCCTGAAGTTACATGG - Intergenic
1055187778 9:73475822-73475844 TGTAGTTCCCCCAAGTCACCTGG + Intergenic
1056471064 9:86904785-86904807 TGGGGTCGCCTGAAGTCCCAGGG + Intergenic
1056791246 9:89626749-89626771 TGGAGTTGCCTGTGGCCACAGGG + Intergenic
1056938266 9:90934466-90934488 GGGAGTTCTCTGAACTGACACGG + Intergenic
1057061105 9:92004451-92004473 ACGAGCTCCCTGAGGTCACATGG + Intergenic
1060200041 9:121646882-121646904 GTGAGTTCCCTAAAGTCACAGGG - Intronic
1060376349 9:123118009-123118031 TGGAGTCACCTCAAGTCAGAGGG + Intronic
1061712544 9:132498109-132498131 AGGAGTTCCCTAGAGTCCCAGGG + Intronic
1062464512 9:136675238-136675260 TGGTGTTCCTGGAAGTCACCGGG + Intronic
1188231709 X:27671880-27671902 TTGAGTTCACTGAAATCTCAAGG + Intronic
1189731482 X:44025531-44025553 GGCAGCTCCCTGAAATCACATGG - Intergenic
1190537723 X:51446432-51446454 TGGTGTTCCCTTAAGGCCCAAGG + Intergenic
1193170816 X:78333451-78333473 TGGAGTTCTCTGAAGGTAAATGG + Intergenic
1193842882 X:86430029-86430051 TGGACTTCACTGAAATCAGATGG - Intronic
1195136242 X:101909594-101909616 TGGTGTTCCCTTAAGGCACAGGG - Intronic