ID: 1135289584

View in Genome Browser
Species Human (GRCh38)
Location 16:21223850-21223872
Sequence CTATATGCATGGTCTCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135289584_1135289590 10 Left 1135289584 16:21223850-21223872 CCATGGAGAGACCATGCATATAG No data
Right 1135289590 16:21223883-21223905 GCTGCTCACCCTGTGGGCGTGGG No data
1135289584_1135289587 3 Left 1135289584 16:21223850-21223872 CCATGGAGAGACCATGCATATAG No data
Right 1135289587 16:21223876-21223898 CTGAGCTGCTGCTCACCCTGTGG No data
1135289584_1135289588 4 Left 1135289584 16:21223850-21223872 CCATGGAGAGACCATGCATATAG No data
Right 1135289588 16:21223877-21223899 TGAGCTGCTGCTCACCCTGTGGG No data
1135289584_1135289589 9 Left 1135289584 16:21223850-21223872 CCATGGAGAGACCATGCATATAG No data
Right 1135289589 16:21223882-21223904 TGCTGCTCACCCTGTGGGCGTGG No data
1135289584_1135289594 18 Left 1135289584 16:21223850-21223872 CCATGGAGAGACCATGCATATAG No data
Right 1135289594 16:21223891-21223913 CCCTGTGGGCGTGGGGCAGGAGG No data
1135289584_1135289591 11 Left 1135289584 16:21223850-21223872 CCATGGAGAGACCATGCATATAG No data
Right 1135289591 16:21223884-21223906 CTGCTCACCCTGTGGGCGTGGGG No data
1135289584_1135289592 15 Left 1135289584 16:21223850-21223872 CCATGGAGAGACCATGCATATAG No data
Right 1135289592 16:21223888-21223910 TCACCCTGTGGGCGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135289584 Original CRISPR CTATATGCATGGTCTCTCCA TGG (reversed) Intergenic
No off target data available for this crispr