ID: 1135293040

View in Genome Browser
Species Human (GRCh38)
Location 16:21256576-21256598
Sequence TGTTACAGGAACATGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135293040_1135293045 25 Left 1135293040 16:21256576-21256598 CCCTGAACCATGTTCCTGTAACA No data
Right 1135293045 16:21256624-21256646 TAACATCTGTCTTCTCTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135293040 Original CRISPR TGTTACAGGAACATGGTTCA GGG (reversed) Intronic
No off target data available for this crispr