ID: 1135295730

View in Genome Browser
Species Human (GRCh38)
Location 16:21278009-21278031
Sequence AAGGAGGAGCAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6752
Summary {0: 2, 1: 27, 2: 287, 3: 1513, 4: 4923}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135295730 Original CRISPR AAGGAGGAGCAGGAAGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr