ID: 1135298002

View in Genome Browser
Species Human (GRCh38)
Location 16:21300247-21300269
Sequence AGTGTATGTTGGAGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135298002_1135298007 -10 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298007 16:21300260-21300282 AACATACACTTGATAGGAGTGGG No data
1135298002_1135298009 -8 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298009 16:21300262-21300284 CATACACTTGATAGGAGTGGGGG No data
1135298002_1135298018 30 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298018 16:21300300-21300322 CATCTGAGTTGGGGGCTGAAGGG No data
1135298002_1135298012 5 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298012 16:21300275-21300297 GGAGTGGGGGAGTGGAGGAGAGG No data
1135298002_1135298013 19 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298013 16:21300289-21300311 GAGGAGAGGCTCATCTGAGTTGG No data
1135298002_1135298015 21 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298015 16:21300291-21300313 GGAGAGGCTCATCTGAGTTGGGG 0: 1
1: 1
2: 0
3: 21
4: 247
1135298002_1135298008 -9 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298008 16:21300261-21300283 ACATACACTTGATAGGAGTGGGG No data
1135298002_1135298017 29 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298017 16:21300299-21300321 TCATCTGAGTTGGGGGCTGAAGG No data
1135298002_1135298011 0 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298011 16:21300270-21300292 TGATAGGAGTGGGGGAGTGGAGG No data
1135298002_1135298016 22 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298016 16:21300292-21300314 GAGAGGCTCATCTGAGTTGGGGG No data
1135298002_1135298010 -3 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298010 16:21300267-21300289 ACTTGATAGGAGTGGGGGAGTGG No data
1135298002_1135298014 20 Left 1135298002 16:21300247-21300269 CCTTTTGTCCTCCAACATACACT No data
Right 1135298014 16:21300290-21300312 AGGAGAGGCTCATCTGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135298002 Original CRISPR AGTGTATGTTGGAGGACAAA AGG (reversed) Intronic
No off target data available for this crispr