ID: 1135304621

View in Genome Browser
Species Human (GRCh38)
Location 16:21357368-21357390
Sequence CTCCAACAGCAGTGGCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135304621_1135304624 1 Left 1135304621 16:21357368-21357390 CCAAACAGCCACTGCTGTTGGAG No data
Right 1135304624 16:21357392-21357414 TGAAATTAAAATGCAGTGGCTGG No data
1135304621_1135304628 25 Left 1135304621 16:21357368-21357390 CCAAACAGCCACTGCTGTTGGAG No data
Right 1135304628 16:21357416-21357438 TCTGGTCATGGCTCCAGGCATGG No data
1135304621_1135304627 20 Left 1135304621 16:21357368-21357390 CCAAACAGCCACTGCTGTTGGAG No data
Right 1135304627 16:21357411-21357433 CTGGTTCTGGTCATGGCTCCAGG No data
1135304621_1135304623 -3 Left 1135304621 16:21357368-21357390 CCAAACAGCCACTGCTGTTGGAG No data
Right 1135304623 16:21357388-21357410 GAGTTGAAATTAAAATGCAGTGG No data
1135304621_1135304625 7 Left 1135304621 16:21357368-21357390 CCAAACAGCCACTGCTGTTGGAG No data
Right 1135304625 16:21357398-21357420 TAAAATGCAGTGGCTGGTTCTGG No data
1135304621_1135304629 26 Left 1135304621 16:21357368-21357390 CCAAACAGCCACTGCTGTTGGAG No data
Right 1135304629 16:21357417-21357439 CTGGTCATGGCTCCAGGCATGGG No data
1135304621_1135304626 13 Left 1135304621 16:21357368-21357390 CCAAACAGCCACTGCTGTTGGAG No data
Right 1135304626 16:21357404-21357426 GCAGTGGCTGGTTCTGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135304621 Original CRISPR CTCCAACAGCAGTGGCTGTT TGG (reversed) Intergenic
No off target data available for this crispr