ID: 1135306423

View in Genome Browser
Species Human (GRCh38)
Location 16:21371154-21371176
Sequence CAGTCTCAGCCCTGGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135306423_1135306429 6 Left 1135306423 16:21371154-21371176 CCTGTGGTCCAGGGCTGAGACTG No data
Right 1135306429 16:21371183-21371205 GGTTAGTGACACACTCACTTTGG No data
1135306423_1135306431 24 Left 1135306423 16:21371154-21371176 CCTGTGGTCCAGGGCTGAGACTG No data
Right 1135306431 16:21371201-21371223 TTTGGCCACAAAATTGAAGGCGG No data
1135306423_1135306430 21 Left 1135306423 16:21371154-21371176 CCTGTGGTCCAGGGCTGAGACTG No data
Right 1135306430 16:21371198-21371220 CACTTTGGCCACAAAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135306423 Original CRISPR CAGTCTCAGCCCTGGACCAC AGG (reversed) Intergenic
No off target data available for this crispr