ID: 1135306536

View in Genome Browser
Species Human (GRCh38)
Location 16:21372022-21372044
Sequence CTGAACTAGAATTTGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135306532_1135306536 -6 Left 1135306532 16:21372005-21372027 CCAAGGTCACACAGTGCCTGAAC No data
Right 1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG No data
1135306531_1135306536 -5 Left 1135306531 16:21372004-21372026 CCCAAGGTCACACAGTGCCTGAA No data
Right 1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135306536 Original CRISPR CTGAACTAGAATTTGGGACA AGG Intergenic
No off target data available for this crispr