ID: 1135314670

View in Genome Browser
Species Human (GRCh38)
Location 16:21434422-21434444
Sequence CTCCATCTTAAATAGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1956
Summary {0: 7, 1: 91, 2: 373, 3: 731, 4: 754}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135314665_1135314670 22 Left 1135314665 16:21434377-21434399 CCGCAGTGGGCAATGATCATGTC No data
Right 1135314670 16:21434422-21434444 CTCCATCTTAAATAGGAGCCGGG 0: 7
1: 91
2: 373
3: 731
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135314670 Original CRISPR CTCCATCTTAAATAGGAGCC GGG Intronic
900203857 1:1422796-1422818 CTCCATCTTGAACAGGGGCTGGG + Intergenic
900301253 1:1978571-1978593 CTCCATCTTCAAAACCAGCCAGG - Intronic
900698357 1:4027073-4027095 CTCCATCAGGAATAGTAGCCTGG - Intergenic
900878776 1:5365679-5365701 CTCCATCTGGAACAGGAGCTGGG - Intergenic
901314493 1:8296868-8296890 CTCCATCTTGAACAGGAGCTGGG - Intergenic
901495833 1:9621245-9621267 CTCCATCTTGAATAGGAGCTGGG - Intergenic
901519859 1:9775244-9775266 CTCCATCTTGAATAGGGTCTGGG - Intronic
901620305 1:10579943-10579965 CTCCATCTTGAGTAGGAGCTGGG - Intronic
901807100 1:11745494-11745516 TTCCATCTTGAATAGGAGCTGGG - Intronic
902045000 1:13517546-13517568 CACCAGCCTAAATGGGAGCCAGG + Intergenic
902900133 1:19509233-19509255 CTCAATCTTGAATAGGGGCTGGG - Intergenic
902947429 1:19851864-19851886 CTCCATCTTAAATAGGAGCTGGG - Intergenic
902978693 1:20107986-20108008 CTCCATCTTGAATAGAAGCTGGG + Intergenic
902998642 1:20248270-20248292 CTCCATCTTAAATAGGAGCTGGG + Intergenic
903456416 1:23490300-23490322 CTCCATCTTGAATAGGGTCTGGG - Intergenic
903472487 1:23597017-23597039 CTCCATCTTGAATAGGGGCTGGG + Intronic
903618278 1:24678602-24678624 CTCCATTTTGAATAGGGGCTGGG + Intergenic
903762483 1:25708576-25708598 CTCCATCTTGAATAGGGACTGGG - Intronic
903877310 1:26484101-26484123 CTGCATCTTAAATAGGAACTAGG - Intergenic
904059370 1:27696006-27696028 CTCCCTCTTGAATAGGAGCTGGG - Intergenic
904361382 1:29974814-29974836 CTCCATCTTAAATATAATCCTGG - Intergenic
904488817 1:30845451-30845473 CTCCATCTTGAATAGGGACTGGG + Intergenic
904526696 1:31139103-31139125 CTCCATCTTGAATAGGGGCTGGG - Intergenic
904583202 1:31563191-31563213 CTGCATCTTGAATAGGGGCTGGG - Intergenic
904587812 1:31589507-31589529 CTCCATCTTGAATAGGGGCCGGG + Intergenic
904587981 1:31590656-31590678 CTCCATCTTGAATAGGAGCTGGG - Intergenic
905428468 1:37903093-37903115 CTCCATCTTGAATAAGAGCTAGG + Intronic
905428912 1:37907506-37907528 CTCCATCTTGAATAGGGGCCAGG + Intronic
906473244 1:46148882-46148904 CTCCATCTTAAATAAGGGCTGGG + Intronic
906859715 1:49346837-49346859 CTCTATCTTGAATAGAAGCTGGG + Intronic
907155587 1:52330814-52330836 CTCCATCTTGAACAGGGGCTGGG - Intronic
907414930 1:54307556-54307578 CTCCATCTTGAAAAGGAGCTGGG + Intronic
907445184 1:54503034-54503056 CTCTGTCTTAAACAGGAGCTGGG + Intergenic
907510160 1:54952041-54952063 TTCCATCTTGAATAGGAGCTGGG + Intergenic
907542965 1:55233299-55233321 CTCCATCTTGAATAGGGGCTGGG - Intergenic
908217355 1:61967086-61967108 CTCCATCTTAAATAGGAGCTGGG - Intronic
908328091 1:63043552-63043574 CTCCGTCTTGAACAGGAGCTAGG + Intergenic
908506160 1:64802317-64802339 CTCCATCTTGAATAGAAGTTAGG - Intronic
908582521 1:65530820-65530842 CTCCATCTTGAGTAGGGGCTGGG - Intronic
908666285 1:66494672-66494694 CTCCATCTGACATAAGGGCCTGG + Intergenic
908748735 1:67399785-67399807 CTCCATCTTGAATAGAGGCTGGG + Intergenic
908851858 1:68385014-68385036 CTCCATCTTGCATAGGCGCTGGG + Intergenic
909014398 1:70367495-70367517 CTCCATCTTGAATAGCGGCTGGG - Intronic
909207745 1:72781044-72781066 TTCCTTTCTAAATAGGAGCCAGG + Intergenic
909268288 1:73590544-73590566 CTCCATCTTGAATGGGGGCTGGG - Intergenic
909800086 1:79796385-79796407 CTCCATCTTGGATAGGAGCTGGG - Intergenic
909856959 1:80547263-80547285 CTTCATCTTGAGTAGGAGCTGGG + Intergenic
910023536 1:82622454-82622476 ATCCATCTTGAATAGAAGCTGGG + Intergenic
910796202 1:91100039-91100061 CTCCATCTCAAATAGGATCTGGG - Intergenic
911152999 1:94613007-94613029 CTCCATCTTAAATAAGAGCTGGG + Intergenic
911153449 1:94617500-94617522 CTCCATCTTGAATAGGGGCTGGG + Intergenic
911189223 1:94931436-94931458 CTCCATCTTGAATAGGGGCTAGG + Intergenic
911278679 1:95896088-95896110 CTCCATCTTGAATAGGGGCTGGG - Intergenic
911576758 1:99587213-99587235 TTCCATCTTGAATAGGGGCTGGG - Intergenic
911847700 1:102775238-102775260 CTCCATCTTAAATAGGAGCTGGG - Intergenic
911951288 1:104176897-104176919 CTCTATCTTGACTAGGAGCTGGG + Intergenic
911953290 1:104204447-104204469 CTCCATCTTTAATAGGAGCTAGG - Intergenic
912001312 1:104838065-104838087 CTCCATCTTGAATAGGAGCTGGG - Intergenic
912125001 1:106524986-106525008 CTCTATCTTGAATAGGGGCTTGG - Intergenic
912218275 1:107642097-107642119 CTCCATCTTAAATGGGAGCTGGG + Intronic
912219146 1:107652013-107652035 CGCCATCTTGAATAGGAGCTGGG + Intronic
912486296 1:110031583-110031605 CTCCATCTTGAACAGGGGCTGGG - Intronic
912819117 1:112853078-112853100 CTCCATCTTGAATAGGGACTGGG + Intergenic
913134488 1:115874687-115874709 CTCCATCTTGAATAGGGGCTGGG - Intergenic
913406006 1:118491085-118491107 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
913471506 1:119191921-119191943 CTCTATCTTGAATAGGGGCTGGG - Intergenic
913669297 1:121080693-121080715 CTCCATCTTGAATAGGGGCTGGG - Intergenic
914021050 1:143868090-143868112 CTCCATCTTGAATAGGGGCTGGG - Intergenic
914257486 1:145972414-145972436 CTCCATCCTAAAAGGGAGCAGGG - Intronic
914437400 1:147671912-147671934 CTCCATCTTGAATAGCGGCTGGG + Intergenic
914442518 1:147719837-147719859 CTCCATTTTGAATAGGGGCTGGG + Intergenic
914558635 1:148794184-148794206 CTCCATCTTGAATACGGGCTGGG - Intergenic
914614200 1:149336046-149336068 CTCCATCTTGAATACGGGCTGGG + Intergenic
914659541 1:149776017-149776039 CTCCATCTTGAATAGGGGCTGGG - Intergenic
914817793 1:151075808-151075830 CTCCATCTTGCATAGGAGTTGGG - Intronic
915039706 1:152958481-152958503 CTCCATCTTGAATAGGAGCTGGG + Intergenic
915218996 1:154358920-154358942 CTCCATCTTGAATAGGGTCTGGG + Intergenic
915364548 1:155307367-155307389 CTCCATCTTGAATAGGGACTGGG + Intergenic
915666666 1:157451327-157451349 TTCCATCTTGAATAGGGGCTGGG - Intergenic
915697062 1:157754100-157754122 CTCCATCTTGAACAGGAGTTGGG + Intronic
915806321 1:158857249-158857271 CTCCATCTTGGATAGGGGCTGGG + Intergenic
916226672 1:162496011-162496033 CTCCATCTTGAATAGGAGCTGGG - Intergenic
916241829 1:162647975-162647997 CTCCATCTTGAATAGGGACTGGG - Intronic
916259905 1:162831414-162831436 CTCCATCTTGAATAGGAACTGGG + Intronic
916532762 1:165673846-165673868 CTTCATCTTAAGTAGGGGCTGGG + Intronic
916687606 1:167161446-167161468 CTCCATCTTGAATAGGGGCTGGG + Intergenic
916810810 1:168304077-168304099 CTCCATCTTGAATAGGGGCCGGG - Intronic
916814069 1:168333707-168333729 CTCCATCTTGAATAGGAGCTGGG - Intergenic
916985122 1:170182668-170182690 CTCCATCTTGAATAGGAGCTGGG + Intergenic
917071738 1:171159058-171159080 CTCCATCTTGAATAGGGGCTGGG + Intronic
917215762 1:172676510-172676532 CTCCATCTTAAATAGGAGCTGGG + Intergenic
917293241 1:173493063-173493085 CTCCATCTTAAATAGGAGCTGGG + Intergenic
917293978 1:173499878-173499900 CTCCATCTTAAATAAGAGCTGGG + Intergenic
917447566 1:175119538-175119560 CTCCATCTTGAATAGGAACTGGG - Intronic
917466069 1:175277310-175277332 CTCCATCTTGAATAGGGACTGGG + Intergenic
917566748 1:176220311-176220333 CTCCATCTTGAATAGGGGCTTGG + Intergenic
917699700 1:177567936-177567958 CTCTCTCTTAAGTGGGAGCCTGG + Intergenic
917834446 1:178930227-178930249 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
917883669 1:179363561-179363583 CTCCATCTTGAATAGGCACTGGG - Intergenic
917899427 1:179527456-179527478 CTCCATCTTAAAGAGTAGCTGGG - Intronic
918024337 1:180728065-180728087 CTCCATCTTGAATAAGGGCTGGG - Intronic
918076325 1:181173963-181173985 CTCCATCTTGAATAGGGGCTGGG + Intergenic
918532690 1:185540480-185540502 CTCCATCTTGAATAGGAGCTCGG - Intergenic
918589753 1:186227782-186227804 CTCCGTCTTGAATAGGGGCTAGG + Intergenic
918949220 1:191114019-191114041 CTTCATCTTGAATAGGGGCTAGG + Intergenic
918968684 1:191383516-191383538 CTCAATCTTCAATAGGAGCTGGG + Intergenic
919337523 1:196256794-196256816 TTCCATCTTGAATAGGGGCTGGG + Intronic
919969104 1:202560735-202560757 CTCCATCTTGAATAGGGGCTGGG - Intronic
920113016 1:203600407-203600429 CTCCATTTTGACTAGGAGCTGGG - Intergenic
920134532 1:203758852-203758874 CTTCATCTTGAATAGGGGCTGGG + Intergenic
920134948 1:203762172-203762194 CTCCATCTCGAATAGGGGCTGGG + Intergenic
920137126 1:203779040-203779062 CTCCATCTTAAATGGCAGCTGGG + Intergenic
920821185 1:209382929-209382951 CTCCATCTTGAATAGGAGCTGGG + Intergenic
920921066 1:210297714-210297736 CTCCATTTTGAATAGGAGTTGGG + Intergenic
921053154 1:211525319-211525341 CTCCATCTTGAATAGTAGCTGGG + Intergenic
921076838 1:211706751-211706773 CTCCATCTTGAATAGGAGCTGGG + Intergenic
921077345 1:211710737-211710759 CTCCATCTTAAATAGGAGCTGGG + Intergenic
921083994 1:211769942-211769964 CTCCATCTTGAGTAGGGGCTGGG - Intronic
921294252 1:213687232-213687254 CTCCATCTTGAATAGGGTCTGGG - Intergenic
922142731 1:222906393-222906415 CTCCATCTTAAATAGGGGCTGGG + Intronic
922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG + Intergenic
922372312 1:224923849-224923871 CTCCAACTTAAATAGGGGTTGGG + Intronic
922422084 1:225466980-225467002 CTCCATCTTGTATAGGGGCTGGG - Intergenic
922815032 1:228442726-228442748 CTCCATCTTGAATAGGGGCTGGG + Intergenic
922815842 1:228448598-228448620 CTCCATCTTGAATAGGGGCTGGG + Intergenic
923019524 1:230152184-230152206 CTCCATCTTGAATAGGAGTTGGG - Intronic
923386629 1:233471596-233471618 CTCTATCTTGAATAGGAGTTGGG + Intergenic
923413750 1:233734602-233734624 CTCCATCTTGAATAGGGGCTGGG + Intergenic
923601864 1:235410651-235410673 CTCCATCTTGAATAGGAGCTGGG - Intronic
923617045 1:235546741-235546763 CTCCATCTTGAATAGGGGCTGGG - Intergenic
923973759 1:239235909-239235931 CTCCATCTTAAATAGGATCTGGG - Intergenic
924048233 1:240054239-240054261 CTCCATCTTGAATAGGGGCTGGG + Intronic
924050475 1:240075392-240075414 CTCCATCTTTAACAGGGGCTGGG - Intronic
924054441 1:240111765-240111787 CTCCATCTTGAATAGAGGCTGGG - Intronic
924204385 1:241696910-241696932 ATCCATCTTGAATAGGGGCTGGG - Intronic
924449181 1:244162412-244162434 CTCCATCTTGAATAGGGGTGGGG - Intergenic
924558357 1:245136596-245136618 CTCCATCTTGAATAGGATCTTGG + Intergenic
924577097 1:245290750-245290772 CTCCATCTTGAATAGGAGCTGGG - Intronic
924646969 1:245887035-245887057 CTCCATCTTGAATAGGGGCCTGG + Intronic
924683919 1:246268076-246268098 CTCCATCTTGAACAGGAGCTGGG + Intronic
1063185384 10:3645860-3645882 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1063472161 10:6296932-6296954 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1063739868 10:8805882-8805904 CTCCATCTTGAGTAGGGGCAGGG + Intergenic
1063751014 10:8947527-8947549 CTTCATCTTGAATAGGAGCTGGG + Intergenic
1063853772 10:10223321-10223343 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1063882123 10:10541889-10541911 CTTCATCTTGAATAGGAGTTGGG - Intergenic
1064075514 10:12265545-12265567 CTCCATCTTAAACAGGAGCTGGG - Intergenic
1064098698 10:12444273-12444295 CTCCATCTTGAATAGGAGCTGGG - Intronic
1064210131 10:13354625-13354647 CTCCATCTTGAATGGGAGCTGGG - Intergenic
1064232095 10:13538068-13538090 CTCCATCTTGAATGGGAGCTGGG + Intergenic
1064333704 10:14418469-14418491 CTCCATCTTGAATAAGGGCTGGG + Intronic
1064334588 10:14427245-14427267 CTCCATCTTGAATCGGGGCTGGG + Intronic
1064470186 10:15627777-15627799 CTCCATCTTGAATAGGGGCTGGG + Intronic
1064699899 10:18007948-18007970 ATCCATCTTGAATAGGAGCTGGG - Intronic
1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG + Intronic
1064814716 10:19246562-19246584 CATCCTCTTAAATAGGAGCCTGG + Intronic
1064938314 10:20704952-20704974 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1064994272 10:21282690-21282712 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1065173546 10:23055111-23055133 CTCCTTCTTGAATAGGAGCTGGG - Intergenic
1065290331 10:24223216-24223238 CTCCATCTTAAATAGGAGCTAGG - Intronic
1065383154 10:25110042-25110064 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1065384749 10:25123870-25123892 CTCCATCTTGAATGGGAGCTGGG + Intergenic
1065441941 10:25762097-25762119 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1065487249 10:26247440-26247462 CTCCATCTTGAATAGGAGCTGGG - Intronic
1065493517 10:26306290-26306312 CTCCATCTTGAATAGGGGCAGGG + Intergenic
1065584016 10:27200066-27200088 CTCCATTTTGAATAGGAGCTGGG + Intronic
1065696562 10:28385979-28386001 CTCCATTTTGAATAGGGGCTGGG + Intergenic
1065742731 10:28811833-28811855 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1065889253 10:30107147-30107169 CTCCATCTTGAATAGGGGCTAGG + Intronic
1066128044 10:32361759-32361781 CTCCATCTTGAATAGGGGCTGGG + Intronic
1066248452 10:33608757-33608779 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1066265950 10:33775760-33775782 CTCCATCTTGAATGGGGGCTGGG - Intergenic
1066268470 10:33798948-33798970 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1066640500 10:37550248-37550270 CTCCATCTTGAATAGGGGCTTGG + Intergenic
1067328065 10:45288521-45288543 CTCCATCTTGAGTAGCAGCTGGG - Intergenic
1067328413 10:45291893-45291915 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1067341737 10:45411380-45411402 CTCCATCTTGAATAGGGGCTGGG - Intronic
1068977154 10:63022399-63022421 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1068977356 10:63024108-63024130 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1069083862 10:64116868-64116890 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1069270211 10:66517283-66517305 CTCCATCTTGAATAGGAGCTTGG + Intronic
1069329672 10:67277517-67277539 CTTCATCTTAAATAGGGGCTGGG + Intronic
1069727544 10:70590773-70590795 CTCCATCTTGAATAGGGCCTGGG - Intergenic
1069785468 10:70985116-70985138 CTCCATCTTGAATAGGGCCTGGG + Intergenic
1069953043 10:72032671-72032693 CTCCATCTTGAATAGAAGCTGGG + Intergenic
1070198316 10:74179321-74179343 CTCCATCTTGAATAGGGTCTGGG + Intronic
1071011721 10:80947966-80947988 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1071013450 10:80966692-80966714 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1071013573 10:80967704-80967726 CTCTATCTTAAATAGGAGCTGGG - Intergenic
1071070125 10:81681851-81681873 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1071082252 10:81826298-81826320 CTCCATCTTGAAAAGGAGCTGGG - Intergenic
1071392025 10:85184811-85184833 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1071392626 10:85190779-85190801 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1071829259 10:89355550-89355572 CTCCATCTTGAATAGGGGCTGGG + Intronic
1072167669 10:92829646-92829668 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1072214261 10:93274580-93274602 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1072215415 10:93283570-93283592 CTCCATCTTGAATAGGGGCCGGG - Intergenic
1072509720 10:96107873-96107895 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1072547993 10:96455391-96455413 CTCCATCTCAAATAGGGGATGGG + Intronic
1072579779 10:96730717-96730739 CCCCATCTTGAATAGGGGCGGGG + Intergenic
1072682310 10:97516307-97516329 CTCCCTCTTACAGAGGACCCAGG + Intronic
1073489711 10:103844892-103844914 CTCCATCTTGAATAAGGGCTGGG + Intronic
1073531467 10:104236400-104236422 CTCCATCTTAAATAGGAGCTGGG + Intronic
1073748128 10:106493397-106493419 CTGCATCTTGAATAGGGGCTGGG - Intergenic
1073917797 10:108426828-108426850 CTCCATCTTCTATAGGCTCCAGG - Intergenic
1073990502 10:109257260-109257282 CTCCATCTTAAATAGGAACTGGG - Intergenic
1074467379 10:113695539-113695561 CTCCATATTGAATAGGGGCTGGG + Intronic
1074592838 10:114829702-114829724 CTCCATCTTGAACAGGAGCTGGG - Intronic
1074614228 10:115050569-115050591 CTCCATCTTGAATACGGGCTGGG + Intergenic
1074690143 10:115997079-115997101 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1074876589 10:117618328-117618350 CTCCATCTTGAGTAGGGGGCTGG + Intergenic
1075022557 10:118962386-118962408 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1075124544 10:119689191-119689213 CTTCACCTTGAATAGGAGCTGGG + Intergenic
1075149086 10:119910389-119910411 CTTCATCTAAAATATGACCCTGG - Intronic
1075653921 10:124148662-124148684 CTCCATCTTGAATAAGAGCTGGG + Intergenic
1075888925 10:125928552-125928574 CTCCATCTTGAATAGGAGCTGGG - Intronic
1075928050 10:126269349-126269371 CTCCATCTTGAATAGGAGCTGGG - Intronic
1075961730 10:126572766-126572788 CTCCATCTTGAATAGGAGCTGGG - Intronic
1075977529 10:126708574-126708596 CTCCATCTTAAATAGGAGCTAGG - Intergenic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1077313319 11:1903162-1903184 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1077784502 11:5367725-5367747 CTCCATCTTAAATAGGAGCTGGG - Intronic
1077859377 11:6161261-6161283 CTCCATCTTGACTAGGAGCTGGG - Intergenic
1077873555 11:6283673-6283695 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1077874013 11:6288230-6288252 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1078422155 11:11221272-11221294 CTCCATCTTGAATAGGGCCTGGG + Intergenic
1078704952 11:13734431-13734453 CTCCATCTTGAATAGGGACTGGG - Intergenic
1079232172 11:18658153-18658175 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1079235025 11:18682052-18682074 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1079308304 11:19344003-19344025 CTGCATCCCAAATAGGGGCCCGG + Intergenic
1079412249 11:20200525-20200547 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1079412892 11:20206741-20206763 TTCCATTTTCAATAGGAGCTGGG + Intergenic
1079528206 11:21415922-21415944 CTCCATCTTCAAGAGGAGTTGGG + Intronic
1079641063 11:22806135-22806157 CTCCATCTTGAATAGGGGCTTGG - Intronic
1079717515 11:23766811-23766833 CTCCATCTTGAATAGGACATGGG - Intergenic
1079717967 11:23771908-23771930 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1079809683 11:24981576-24981598 CTCCATCTTGAATAGAGGCTGGG - Intronic
1080076257 11:28153227-28153249 AACCATCTTGAATAGGAGCTGGG - Intronic
1080077700 11:28170928-28170950 CTCCATCTTGAATAGGGGCTGGG - Intronic
1080288599 11:30644947-30644969 CTCCATCTTGGGTAGGAGCTGGG + Intergenic
1080352780 11:31404280-31404302 CTCCATCTTGAATAGGAGCTGGG - Intronic
1080806314 11:35657281-35657303 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1081424188 11:42906902-42906924 CTCCATCTTAAACAGGGGCTGGG - Intergenic
1081606563 11:44530912-44530934 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1081970080 11:47192266-47192288 CTCCAGCTTGAATAGGGGCTGGG + Intergenic
1082058995 11:47844739-47844761 CTCCATCTTGAATAGGAGTTGGG + Intronic
1082284887 11:50307546-50307568 CTTGATTTTAAATAGGAGCTGGG - Intergenic
1082867309 11:57911678-57911700 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1082992101 11:59215897-59215919 CTCCATCTCGAATAGGGGCTGGG - Intergenic
1083025618 11:59548254-59548276 CTGCATCTTGAATAGGGGCTGGG - Intergenic
1083045816 11:59733859-59733881 CTCCATCTTGAATAGGGGCTGGG - Intronic
1083283155 11:61639938-61639960 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1083286068 11:61659808-61659830 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1083349054 11:62014087-62014109 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1083483528 11:62966075-62966097 CTCCATCTTTAATAGGGGCTAGG - Intronic
1083701865 11:64484797-64484819 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1083910970 11:65709691-65709713 CTCTATCTTGAATAGAAGCTGGG + Intergenic
1084109630 11:67005411-67005433 CTCCATCTTGAGTAGGGGCTTGG + Intergenic
1084193675 11:67511018-67511040 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1084635794 11:70391684-70391706 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1084786132 11:71442605-71442627 CTCCATTTTAAAAAGGTGACTGG - Intronic
1084878968 11:72155974-72155996 CCCCATCTTGAATAGGGGCTGGG - Intergenic
1085182775 11:74549986-74550008 CTCCATCTTAAATAGGGGCTGGG + Intronic
1085953349 11:81359733-81359755 CTCCATCTTGAATAGGGGCTTGG - Intergenic
1085963705 11:81495656-81495678 CTCCATCTTGAATAGGTGCTAGG + Intergenic
1085974874 11:81640535-81640557 CTCCATCTCAAATAGGAGCTGGG + Intergenic
1086312422 11:85549569-85549591 CTCCATCTTGTATAGGGGCTAGG + Intronic
1086390288 11:86356631-86356653 CTCCATCTTAAATAGGAACTAGG + Intergenic
1086453221 11:86937391-86937413 CTCCATCTTGAGTAGGGGCTGGG + Intronic
1086572776 11:88304551-88304573 CTCCATCTTGAATAGGAGCTGGG + Intronic
1086782378 11:90923344-90923366 CTTCATCTTGAATAGGAGCTGGG + Intergenic
1086920638 11:92582331-92582353 CTCCATCTTGAATAGGAGCTGGG - Intronic
1087251400 11:95904401-95904423 CTCCATCTTGAATAGGGGCTGGG + Intronic
1087304672 11:96474430-96474452 CTCCATGTTGAATAGGTGCTGGG + Intronic
1087438585 11:98153929-98153951 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1087531403 11:99386701-99386723 CTCCATCTTGAATAGGAGCTGGG - Intronic
1087663462 11:101014775-101014797 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1087843072 11:102940061-102940083 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1087991362 11:104747943-104747965 CTCCATCTTGAATAGAAGCTGGG + Intergenic
1087992985 11:104769123-104769145 CTCCATCTTGAATAGAAGCTGGG - Intergenic
1088102493 11:106170678-106170700 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1088212915 11:107475993-107476015 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1088253528 11:107881886-107881908 CTCCATCTTGAATAGGAGCTAGG - Intronic
1088317071 11:108518675-108518697 CTCCATCTCGAATAGGGGCTGGG + Intronic
1088481414 11:110299221-110299243 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1088486811 11:110348611-110348633 CTCCATCTAGAATAGGAGCTAGG - Intergenic
1088581339 11:111319801-111319823 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1088641864 11:111880319-111880341 CTCCGTCTTGAATAGGGGCTAGG + Intronic
1088953604 11:114595801-114595823 CTCCACCTTAAGGAGGGGCCTGG + Intergenic
1088998962 11:115032912-115032934 CTCCAACTTAGATAGCAGCTGGG + Intergenic
1089312894 11:117571717-117571739 CTCCATCTTGAATAGGGGCTGGG + Intronic
1089385204 11:118062788-118062810 TTCCAGCTTGAATAGGAGCTGGG + Intergenic
1089470054 11:118713455-118713477 CTCCATTTTGAATAGGGGCTGGG - Intergenic
1089486949 11:118853912-118853934 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1089542915 11:119201268-119201290 CTCCACCTTGAAGAGGAGCTGGG + Intergenic
1089749644 11:120641856-120641878 CTGCATCTTGAATAGGAGCTGGG - Intronic
1090037420 11:123260987-123261009 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1090455269 11:126843611-126843633 CTCCATCCTGAATAGGGGCTGGG + Intronic
1091410162 12:233880-233902 CTCCAGCTTGAATAGGGGCTGGG + Intronic
1092354921 12:7786842-7786864 CTCCATCTTCAATAGGAGCTGGG - Intergenic
1092367629 12:7890170-7890192 CTCCATCTTCAATAGGAGCTGGG - Intronic
1092460223 12:8679846-8679868 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1092652892 12:10653863-10653885 CTCCATCTTGAACAGGGGCTTGG + Intronic
1092653518 12:10660501-10660523 CTCCATCTTGAATAGCAACTGGG + Intronic
1092782021 12:11996188-11996210 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1092782337 12:11998891-11998913 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1092813872 12:12295861-12295883 CTCCATCTTAAATAGAAGCTGGG - Intergenic
1093091361 12:14924712-14924734 CTCCATCTTGAATAGGGGATAGG + Intronic
1093170482 12:15854100-15854122 CTCCATCTTGAATAGGGGCTAGG - Intronic
1093421577 12:18980197-18980219 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1093461875 12:19414301-19414323 CTCCATCTTGAATAGGAGCTGGG - Intronic
1093732658 12:22583491-22583513 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1093735235 12:22613606-22613628 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1093741937 12:22699146-22699168 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1093788316 12:23217368-23217390 CTCCATCTTGAATAGGGTCTGGG - Intergenic
1093924177 12:24892153-24892175 CTCCATCCTGAATAGGGGCTGGG - Intronic
1094100024 12:26752268-26752290 CTCCATCTTGAAAAGGAGCTGGG + Intronic
1094100456 12:26756816-26756838 CTCCATCTTGAATAGGAGCTGGG + Intronic
1094146208 12:27230947-27230969 CTCCATCTTGAATAGAGGCTGGG - Intergenic
1094221742 12:28001282-28001304 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1094488335 12:30942320-30942342 CTCCATCTTACAGAGGAGGAAGG + Intronic
1094594460 12:31852040-31852062 CTCCATCTTGAAAAGGGGCTGGG + Intergenic
1094618127 12:32054745-32054767 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1094715623 12:33012343-33012365 CTTCATCTTAAACAGGGGCTGGG + Intergenic
1095156643 12:38864392-38864414 GTCAAACGTAAATAGGAGCCAGG - Intronic
1095157621 12:38877816-38877838 CTCCATCTTGAATAGGGGCTAGG + Intronic
1095158972 12:38893192-38893214 CTCCATCTTGAATAGGGGCTGGG + Intronic
1095305771 12:40637474-40637496 CTCCATCTTGAATAGGGGCTTGG + Intergenic
1095478189 12:42607636-42607658 CTCCATCTTGAATAGTGGCTGGG + Intergenic
1095479595 12:42621451-42621473 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1095602353 12:44028360-44028382 TTCCATCTTGAATAGGAGCTGGG + Intronic
1095820764 12:46476359-46476381 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1095904686 12:47365867-47365889 CTCCATCTTGAATAGGGACTGGG + Intergenic
1095978845 12:47958737-47958759 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1096337242 12:50765577-50765599 CTCCATCTTAAACAGGAGCTGGG + Intronic
1096379452 12:51143656-51143678 CTCCATTTTAAAGAGAAGCATGG + Intronic
1096509745 12:52121253-52121275 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1096886481 12:54724011-54724033 CTCCATCTTGAATAGGGACGGGG - Intergenic
1096905733 12:54933706-54933728 CTCCATCTTGAATAGGGGATGGG - Intergenic
1097116245 12:56699509-56699531 CTCCATCTTGAATAGGAGCAGGG - Intergenic
1097331780 12:58339322-58339344 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1097338634 12:58412876-58412898 CTCCATCTTGAATAGGGACTGGG - Intergenic
1097456492 12:59804629-59804651 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1097591806 12:61583508-61583530 CTCCACCTTACGTAGGAGCTGGG - Intergenic
1097963718 12:65557296-65557318 CTCCATCTTGAGTAGGGGCTCGG + Intergenic
1097964231 12:65562026-65562048 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1098035093 12:66293520-66293542 ATCCATCCTAAGAAGGAGCCAGG - Intergenic
1098228846 12:68352226-68352248 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1098401159 12:70077669-70077691 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1098569526 12:71973172-71973194 CTCCTTCTTGAATAGGGGCTGGG + Intronic
1098640727 12:72835659-72835681 CTCCATCTTGAATAGCGGCTGGG - Intergenic
1098926122 12:76350787-76350809 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1098938577 12:76508478-76508500 CTCCATCTTGAATAGGGACTGGG + Intronic
1098975996 12:76902720-76902742 CCCCATCTTAAATAGGTGCTGGG + Intergenic
1099008962 12:77268494-77268516 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1099172067 12:79376639-79376661 CTCCATCTTAAATAGGAGCTGGG - Intronic
1099244102 12:80173691-80173713 CTCCATCTTGAATAGGGACTGGG - Intergenic
1099854348 12:88144245-88144267 CTCCATCTTGAATAGGGGCTGGG - Intronic
1100120394 12:91363108-91363130 TTCCATCTTGAATAGGTGCTGGG - Intergenic
1100426655 12:94493610-94493632 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1100426815 12:94495191-94495213 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1100448676 12:94684624-94684646 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1100597362 12:96083162-96083184 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1100727189 12:97421078-97421100 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1100811826 12:98346130-98346152 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1101686949 12:107033968-107033990 CTCCATCTTAAATAGGGCCTTGG + Intronic
1101694300 12:107109913-107109935 CTCCGTCTTAAATAGGGGCTGGG + Intergenic
1101799368 12:108007304-108007326 CTCCATCTTGAATAGGGACTGGG - Intergenic
1101856078 12:108444155-108444177 CTCCATCTTAAATAGGACCTGGG - Intergenic
1101857314 12:108454753-108454775 CTCCATCTTAAATAGGACCTGGG + Intergenic
1101921204 12:108934525-108934547 CTCCATCTTGAATAGGGGTTGGG + Intronic
1102074674 12:110050370-110050392 CTCCATCTTAAATAGGAGCTGGG + Intronic
1102100112 12:110271816-110271838 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1102170812 12:110841307-110841329 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1102389989 12:112541851-112541873 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1102394978 12:112577644-112577666 CTCCATCTTGAATAGGGGCTGGG - Intronic
1102412805 12:112735035-112735057 CTCCATCTTGAATAGGGGCTGGG - Intronic
1102526144 12:113513778-113513800 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1102536356 12:113584279-113584301 CTCCATCTTGACCAGGAGCTGGG - Intergenic
1102774406 12:115506200-115506222 CTCCATCTTCAATAGGGGCTGGG + Intergenic
1102871518 12:116417777-116417799 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1102872995 12:116428382-116428404 CTCTATCTTAAATAGGAACTGGG + Intergenic
1102890696 12:116556532-116556554 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1103044249 12:117722325-117722347 CTCCATCTTGAAGAGGAGCTGGG + Intronic
1103132196 12:118479102-118479124 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1103134014 12:118492034-118492056 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1103868571 12:124073917-124073939 CTGCATCTTGAATAGGGGCTGGG - Intronic
1103872092 12:124099432-124099454 CTAGATCTGAATTAGGAGCCTGG - Intronic
1103964626 12:124630931-124630953 CTCCATCTTGAACAGGGGCCGGG + Intergenic
1104195658 12:126534846-126534868 CTCCAACTGAAGTAGGAGACTGG - Intergenic
1104233018 12:126903575-126903597 CTCCATCTTAAACAGGAACTGGG - Intergenic
1104233499 12:126908486-126908508 CTCCATCTTGAATAGGTCCTGGG - Intergenic
1104237522 12:126953486-126953508 CTCCATCTTGAATAAGGGCTTGG + Intergenic
1104307597 12:127623536-127623558 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1104361720 12:128139306-128139328 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
1104371063 12:128224351-128224373 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1104372786 12:128238047-128238069 CTCCATCTTGAATAGAAGCTGGG + Intergenic
1104448268 12:128850223-128850245 CTCCCTCTTGAATAGGGGCTGGG - Intergenic
1104464440 12:128979101-128979123 CTCCATCTTGAATAGCAGCTGGG - Intronic
1104466696 12:128996133-128996155 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1104640472 12:130463717-130463739 CTCCATCTTGAATAGGGGCTGGG + Intronic
1104671477 12:130683495-130683517 CTCCATCTTGAATAGGGGCTGGG + Intronic
1105053787 12:133079237-133079259 CTCCATCTTAAATAAGAACTGGG + Intergenic
1105778158 13:23681797-23681819 ATCCATCTTAAATAGGAGCTGGG + Intergenic
1105778576 13:23686079-23686101 CTCCATCTTAAATAGGAACTGGG + Intergenic
1105779409 13:23693889-23693911 CTTCATCTTGAATAGGGGCTGGG - Intergenic
1105884615 13:24631165-24631187 CTCCATCTTGAATAGGAGATGGG + Intergenic
1106016948 13:25878692-25878714 CTCCATCTTGAATAGGGGCTGGG - Intronic
1106041266 13:26096138-26096160 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1106302555 13:28482420-28482442 CTCCATCTCAAAAAAAAGCCTGG + Intronic
1106331825 13:28746413-28746435 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1106397954 13:29399416-29399438 CTGCATCTTGAATAGGAGATGGG - Intronic
1106590950 13:31098148-31098170 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1106765912 13:32913802-32913824 CTCCAGCTTTTAGAGGAGCCAGG + Intergenic
1106926855 13:34622551-34622573 CTCCACCTTGAATAGGAGCTGGG + Intergenic
1107020082 13:35742277-35742299 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1107020485 13:35746007-35746029 CTCCATTTTGAATAGGGGCTGGG - Intergenic
1107069939 13:36258325-36258347 CTCCATCTTGAATAGAGGCTAGG + Intronic
1107104268 13:36626555-36626577 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1107127905 13:36864343-36864365 CTCCATCTTGAATAGGGGTTAGG + Intronic
1107174474 13:37384549-37384571 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1107215927 13:37918856-37918878 CTCCACCTTGAGTAGGAGCTGGG + Intergenic
1107311803 13:39086437-39086459 CTCCATTTTTAATAGGGGCTGGG + Intergenic
1107376051 13:39805799-39805821 CTCCATGTTGAATAGGAGCTGGG - Intergenic
1107465941 13:40650416-40650438 CTCCATTTTGAATAGGAGCTGGG - Intronic
1107708698 13:43131947-43131969 CTCCATCTTGAATAGGAGTTGGG - Intergenic
1107932409 13:45317173-45317195 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1107971139 13:45643620-45643642 CTTCATCTTGAATAGGAGCTGGG + Intergenic
1108391506 13:49952076-49952098 CTCCGTCTTGAATAGGGGCTGGG - Intergenic
1108507719 13:51127837-51127859 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1108508241 13:51132729-51132751 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1108509181 13:51139460-51139482 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1108528328 13:51304565-51304587 CTCCATCTTGAAGAGGAGCTGGG + Intergenic
1108694113 13:52887648-52887670 TTCCATCTTGAATAGGTGCTGGG - Intergenic
1108737154 13:53296415-53296437 CTCCATCTTGAATAGCGGCTGGG + Intergenic
1108913975 13:55586197-55586219 CTCCATCATGAATAGGAGCTGGG + Intergenic
1109153780 13:58878379-58878401 CTCCATTTTGAATGGGAGCTGGG - Intergenic
1109177397 13:59173367-59173389 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1109201760 13:59439458-59439480 CTACACTTTAAAAAGGAGCCCGG + Intergenic
1109313586 13:60723653-60723675 CCCCACTTTAAATAAGAGCCTGG + Intergenic
1109346281 13:61118051-61118073 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1109497136 13:63187715-63187737 CTCCATCTTGAATAGGGACTGGG - Intergenic
1109527718 13:63598428-63598450 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1109610479 13:64758359-64758381 CTCCATCTTGAATAGGAGCTTGG - Intergenic
1109652828 13:65352551-65352573 CTCCATCTTGAAGAGGAGCTGGG - Intergenic
1109704699 13:66074396-66074418 CTCCATCTTGACTAGGAGCTAGG - Intergenic
1109791900 13:67259687-67259709 CTGCATCTCGAATAGGAGCTGGG - Intergenic
1109827450 13:67741060-67741082 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1109838205 13:67886599-67886621 CTTCATCTTGAATAGGGGGCGGG - Intergenic
1109897946 13:68719117-68719139 CTCCGTCTTAAACAGGAGCTGGG + Intergenic
1109936273 13:69289192-69289214 TTCCATCTTGAATAGGAGCTGGG + Intergenic
1110406856 13:75160548-75160570 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1110684614 13:78357599-78357621 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1110784562 13:79508783-79508805 CTCCATCTTGAATAGGAACTGGG - Intronic
1111127622 13:83931594-83931616 CTTCATCTTGAATAGTAGCTGGG - Intergenic
1111242899 13:85498935-85498957 CACCATCTTAAACGGGAGCTGGG + Intergenic
1111563013 13:89977384-89977406 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1112255469 13:97826596-97826618 CTCCATCTTGAATTGGGGCTGGG + Intergenic
1112585312 13:100713785-100713807 CTTCCTCTTAAACAGGGGCCTGG + Intergenic
1112591425 13:100766826-100766848 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1112595506 13:100803736-100803758 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
1112720206 13:102235770-102235792 CTCTATCTTGAATAGGTGCTGGG + Intronic
1112903828 13:104392396-104392418 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1112934624 13:104782351-104782373 CTCCATCTTGAATAGAGGCTGGG - Intergenic
1113089783 13:106605141-106605163 CTCCATGTTGAATAGGAGCTAGG + Intergenic
1113236207 13:108277977-108277999 CTCCATCTTGGATAGGAGCTGGG - Intronic
1113519026 13:110925182-110925204 CTCCATCTTGAATAGGGACTGGG + Intergenic
1113523783 13:110958193-110958215 CTCCATCTTGAGTAGGGGCTCGG + Intergenic
1113845832 13:113390790-113390812 CTCCATCTTGAGTAGGAGCTGGG + Intergenic
1113862657 13:113499410-113499432 CTCCATCTTGAATATGAGCAGGG - Intronic
1114146493 14:19983480-19983502 TTCCATCTTAAACAGGAGCTAGG - Intergenic
1114344017 14:21776834-21776856 CTCCATCTTGAATGGGGGCTGGG + Intergenic
1114393037 14:22330791-22330813 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1114505536 14:23209394-23209416 CTCCATCTTAAATAGGAGCTGGG - Intronic
1114562731 14:23604930-23604952 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1114583789 14:23790716-23790738 CCCCATCTTGAACAGGAGCTGGG - Intergenic
1114584266 14:23795449-23795471 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1114764532 14:25355998-25356020 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1114789863 14:25645465-25645487 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1114790314 14:25650478-25650500 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1114940530 14:27604468-27604490 CTCCATTTTGAATAGAAGCTGGG - Intergenic
1115129814 14:30041957-30041979 CTCCATCTTGAATAAGACCTGGG + Intronic
1115147017 14:30237908-30237930 CTCCATCTTAAGTAGGGGCTAGG + Intergenic
1115239150 14:31237496-31237518 CTCCATATTGAATAGGAGCTGGG - Intergenic
1115239748 14:31242695-31242717 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1115315802 14:32023795-32023817 CTCCATCTTAAACAGGAAGTGGG + Intergenic
1115482375 14:33874013-33874035 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1115701555 14:35958480-35958502 CTCCATCTTTAATAGGGGCTGGG + Intergenic
1116229521 14:42198546-42198568 CTCCATCTTAAATAGGAGTTGGG - Intergenic
1116256459 14:42562659-42562681 CTCCATCTTGGATAGGGGCTGGG + Intergenic
1116329306 14:43576504-43576526 CTCCATCTTAAATAGAAGCTGGG + Intergenic
1116329936 14:43583028-43583050 CACCATCTTGAATAGGAGCTGGG + Intergenic
1116523492 14:45877083-45877105 CTCCATATTGAATAGGGGCTGGG + Intergenic
1116556735 14:46320880-46320902 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1116593424 14:46809151-46809173 CTGCATTTTGAATAGGAGCTGGG - Intergenic
1116787874 14:49308001-49308023 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1116897678 14:50333155-50333177 CACCATCTTGAATAGGGGCTGGG + Exonic
1116957318 14:50938002-50938024 CTCCATCTTGAATAGGAGCTGGG + Intronic
1117416322 14:55499915-55499937 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1117515866 14:56500544-56500566 CTCCATCTTGAATAGGGGTTGGG - Intronic
1117956088 14:61124712-61124734 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1117969276 14:61236264-61236286 CTCCATCTTAAATAGGAGATAGG + Intronic
1118113415 14:62748506-62748528 CTCCATCTTGAATAAGGGCTGGG - Intronic
1118118217 14:62805902-62805924 CTCCATCTTGAATAGGTGCTGGG + Intronic
1118118630 14:62810405-62810427 GTCCATCTTGAATAGGAGCTGGG + Intronic
1118175579 14:63436877-63436899 CTCCATCTTGAACAGGGGCTGGG + Intronic
1118273320 14:64363451-64363473 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1118304527 14:64644729-64644751 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1118399366 14:65365423-65365445 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1118427803 14:65686030-65686052 CTCCAACTTGAATAGGGGCTGGG - Intronic
1118538221 14:66792226-66792248 CTCCATCTTAAATAAGGGCTAGG - Intronic
1118578482 14:67268859-67268881 CTCCATCTTGAATAGGGGCTGGG - Intronic
1118869500 14:69729228-69729250 CTCCATCTTGAATAGGGGCTGGG - Intronic
1118947716 14:70403365-70403387 CTCCATCTTGAATAGGAGCTAGG + Intronic
1118949301 14:70419443-70419465 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1118997884 14:70853800-70853822 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1118998069 14:70855473-70855495 CTCTATCTTGAATAGGGGCTGGG + Intergenic
1119042905 14:71291107-71291129 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1119102921 14:71896625-71896647 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1119109196 14:71955838-71955860 CTCCATCTTGAGTAGGGGCTGGG - Intronic
1119221029 14:72907492-72907514 CTCCATATTAAATAGGAGCTGGG + Intergenic
1119252692 14:73170334-73170356 CTCTATCTTGAATAGGGGCTGGG - Intronic
1119562235 14:75599951-75599973 CTCCATCTTGAATAGGGGCTGGG + Intronic
1119578546 14:75752251-75752273 CTCCATCTTGAACAGGGGCTGGG - Intronic
1119691902 14:76679715-76679737 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1119720054 14:76884483-76884505 CTCCATATTGAATAGGAGCTGGG - Intergenic
1119943854 14:78670509-78670531 CTCCATATTGAATAGGGGCTGGG - Intronic
1120044356 14:79789881-79789903 CTCCATCTTGAATAGGAGCTGGG - Intronic
1120229482 14:81827392-81827414 CTCCATCTTGAATAGGGGGTAGG - Intergenic
1120233648 14:81866406-81866428 CTCCCTCTTAAACAGGAGATGGG + Intergenic
1120289136 14:82544890-82544912 CTCCATCTTAAATAGGGGCTGGG + Intergenic
1120436070 14:84484396-84484418 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1120436935 14:84494154-84494176 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
1120662298 14:87264738-87264760 CTCCATCTTGAATAGGGGATGGG - Intergenic
1120865829 14:89294472-89294494 CTCCATCATGAATAGGGGCTGGG + Intronic
1120884184 14:89439248-89439270 CTCCATCATGAATAGGAGCTGGG + Intronic
1120895263 14:89525111-89525133 GTCCATCTTGAATAGGGGCTGGG + Intronic
1120913084 14:89685538-89685560 TTCCAACTTGAATAGGAGCTGGG + Intergenic
1120959687 14:90113481-90113503 CACCATCTTCAATTGGATCCTGG + Intronic
1121149475 14:91618392-91618414 CTTCATCTTGAATAGGAGCTGGG - Intronic
1121194053 14:92054238-92054260 CTCCATCTTGAATAGGAGCTGGG + Exonic
1121194382 14:92056807-92056829 CTCCATCTTGAATAGGGGGTTGG + Exonic
1121260982 14:92565900-92565922 CTCCATCTTAAATAGGGGCTGGG - Intronic
1121462219 14:94089681-94089703 CTCCATCTTGAATAAGAGCTGGG - Intronic
1121610455 14:95275179-95275201 CTCCATCTTGAATAGGGGCTGGG + Intronic
1121673545 14:95732751-95732773 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1121794056 14:96721153-96721175 CTCCATCTTGAATAGGAGCTTGG - Intergenic
1122141110 14:99663644-99663666 CTCCATCTTAAATAAGAGCTGGG - Intronic
1122638692 14:103143700-103143722 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1122677493 14:103427987-103428009 CTCCATCTTGAAAAGGGGCTGGG - Intronic
1122949311 14:105032479-105032501 CTCCACCTTGAATAGGGGCTGGG + Intergenic
1123139408 14:106060789-106060811 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1123156647 14:106233697-106233719 CTTCATCTTGAATAGGGGCTAGG - Intergenic
1124387422 15:29222028-29222050 CTCCATCTTGGATAGGGGCTGGG + Intronic
1124438935 15:29673376-29673398 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1124465207 15:29932176-29932198 CTCCATCTTGAATAGAGGCTGGG - Intronic
1124720795 15:32109484-32109506 CTCCATCTTAAATAGGAGCTGGG - Intronic
1124795964 15:32780167-32780189 CTCCATCTTCAATAGAAGCTGGG + Intronic
1124958580 15:34377083-34377105 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1124989376 15:34656220-34656242 CTCCATCTTGAACAGGGGCCGGG + Intergenic
1125460715 15:39904293-39904315 CTCCATCTTGAACAGAAGCTGGG - Intronic
1125690997 15:41596130-41596152 CTCCATCTTGAATAGGTACTGGG - Intergenic
1126152155 15:45533121-45533143 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1126172837 15:45708536-45708558 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1126699633 15:51356274-51356296 CTCCATCTTGAATAGGGGCTGGG - Intronic
1126726202 15:51635025-51635047 CTCCATCTTGAATAGAGGCTGGG - Intergenic
1127162423 15:56203490-56203512 CTCCATCTTAAATAGGAGCTGGG + Intronic
1127212137 15:56784250-56784272 CTCCATCTTGAATAGGGGCTGGG + Intronic
1127344567 15:58081194-58081216 CTCCATCTTGAATAGGAGCTGGG - Intronic
1127508171 15:59614815-59614837 CTCCATCTTGAATAAGGGCTGGG - Intronic
1127522853 15:59760355-59760377 CTCAATCTTGAATAGGGGCTGGG + Intergenic
1127888623 15:63227203-63227225 CTCCATCTTAAACAGGAGCTGGG - Intronic
1127949796 15:63793821-63793843 CTCCACCTTGAGTAGGAGCTGGG + Intronic
1128148681 15:65347503-65347525 CTCCATCTTAAACACGAGTTGGG + Intronic
1128221425 15:65971437-65971459 CCCCACCTTGAATAGCAGCCAGG + Intronic
1128342004 15:66829004-66829026 CTCCATCTTGAATAGGGACTGGG + Intergenic
1128429064 15:67573580-67573602 CTCCATCTTGAATAGAAGCTGGG + Intronic
1130074220 15:80674826-80674848 CTCCGTCTTAAATAGGAACTAGG + Intergenic
1130084924 15:80770010-80770032 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1131002657 15:88951004-88951026 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1131113889 15:89782315-89782337 TTCCATCTTGAATAGGGGCTAGG + Intergenic
1131365980 15:91840076-91840098 CTCCATCTTGAATAGGAGCTTGG - Intergenic
1131549410 15:93344024-93344046 CTCCATCTTGAATAGGTGCTGGG - Intergenic
1131551960 15:93364914-93364936 TGCCATCTTGAATAGGAGCTGGG + Intergenic
1131564508 15:93473486-93473508 CTCCATCTTGAACAGGTGCTGGG - Intergenic
1131626198 15:94123340-94123362 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1131838509 15:96413698-96413720 CTCCATCTGACAGAAGAGCCAGG + Intergenic
1132083806 15:98890187-98890209 CTGCATCTTGAATAGGAGCTAGG + Intronic
1133148730 16:3810361-3810383 CTCCATCAACAAAAGGAGCCTGG + Intronic
1133493819 16:6297313-6297335 CTCCATCTTGAATATGGGCTGGG - Intronic
1133561854 16:6957724-6957746 CTCCATCTTCAATAGGGGCTGGG - Intronic
1133562372 16:6962019-6962041 CTCCATCTTGAATAGGGGCTGGG - Intronic
1133569260 16:7025495-7025517 CTCCATCTTCCATAGGGGCTGGG - Intronic
1133570729 16:7037423-7037445 CTCCATCTTGAATAGGGGCTGGG - Intronic
1133641509 16:7721780-7721802 CTCCATCTTGAATAGGGGCGGGG + Intergenic
1133655417 16:7857696-7857718 CTCCATCTTGAATAAGAGCTGGG - Intergenic
1133844032 16:9437941-9437963 CTCCATCTTAAATAGGGGCTAGG - Intergenic
1133882381 16:9795093-9795115 CTCCATCTTAAATAGTAGCTGGG + Intronic
1133943006 16:10326063-10326085 CTCCATCTTAAATAGGAACTGGG - Intergenic
1134000219 16:10777084-10777106 CTCCATCTTGAATAGGGGCTGGG - Intronic
1134097558 16:11428755-11428777 CTCCATCTTGAATAGGGGCTGGG - Intronic
1134128670 16:11633363-11633385 CTCCATCTTGAATAGGGGCTGGG + Intronic
1134199185 16:12183657-12183679 CTCCATCTGGAATAGGGGCTGGG + Intronic
1134236893 16:12473561-12473583 CTCCATCTTGAATAGGGGCTGGG + Intronic
1134280013 16:12808950-12808972 CTCCATCTTGAATAGGGGATGGG + Intergenic
1134328783 16:13231099-13231121 CCCCATCTTGAATAGCAGCTGGG - Intronic
1134380986 16:13725634-13725656 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
1134583169 16:15388878-15388900 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1134594857 16:15488081-15488103 CACCATCTTGAATAGGGGCTGGG - Intronic
1134605916 16:15571139-15571161 CTCCATCTTGAATAGGGGCTGGG - Intronic
1134691417 16:16192996-16193018 CTCCATCTTGAATAGGGACTGGG + Intronic
1134790155 16:16982458-16982480 CTCCATCTTGAATAGGCGCTGGG - Intergenic
1134800778 16:17082582-17082604 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1134866648 16:17613079-17613101 CTCTATCTTGAATAGGGGCTAGG + Intergenic
1135120361 16:19761179-19761201 CTCCATCTTGAATAGGGGCTGGG - Intronic
1135169751 16:20173384-20173406 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1135308740 16:21389078-21389100 CTCTATCTTGAATAGGGGCTGGG - Intergenic
1135314670 16:21434422-21434444 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135367593 16:21866702-21866724 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135444221 16:22504460-22504482 CTCCATCTTAAATAGGAGCCGGG - Intronic
1135633282 16:24052912-24052934 CTCCATCTTGAATAGGGGCTGGG - Intronic
1135654333 16:24234489-24234511 CTCCATCTTGAATAGGGACTGGG - Intergenic
1135667685 16:24349834-24349856 CTCCATCTTGAATAGGGGATAGG - Intronic
1135810154 16:25579497-25579519 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1135811109 16:25587580-25587602 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1135957667 16:26969770-26969792 CTCCATCTTAAATAGGGGCTGGG + Intergenic
1135959685 16:26985287-26985309 CTCCATCTGCTATAGGAGCTGGG + Intergenic
1136148322 16:28329382-28329404 CTCTATCTTGAATAGGGGCTGGG - Intergenic
1136193115 16:28630499-28630521 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1136305483 16:29368209-29368231 CTCTATCTTGAATAGGGGCTGGG - Intergenic
1136311334 16:29413104-29413126 CTCCATCTTAAATAGGAGCCGGG + Intergenic
1136324782 16:29514897-29514919 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1136439467 16:30254882-30254904 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1136558304 16:31022254-31022276 CTCCATCTTGAATAGGAACTGGG - Intergenic
1137042579 16:35626927-35626949 CTCCATCTTGAATATGGGCTAGG + Intergenic
1137402391 16:48164105-48164127 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1137691939 16:50434530-50434552 CTCCATTTTGAATAGGAGGTGGG - Intergenic
1137695345 16:50458091-50458113 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1137700528 16:50494715-50494737 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1137744990 16:50813911-50813933 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1137745305 16:50816153-50816175 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1137856035 16:51795593-51795615 CTCCATCTTGAATAGGGACTGGG + Intergenic
1137937195 16:52645896-52645918 GTCCATCTTAAATAGGGGATGGG + Intergenic
1138014868 16:53419224-53419246 CTCCATCTTGAATAGGGGTTGGG + Intergenic
1138165192 16:54794748-54794770 CTCCATCTTGAATAGAGGCTAGG - Intergenic
1138247463 16:55478507-55478529 CTCCATCTTGAACAGGGGGCTGG - Intronic
1138453877 16:57109879-57109901 CTCCATCTTGAATAGGAACTGGG - Intronic
1138470007 16:57226853-57226875 CTCCATCTTGAATAGGGGCAGGG - Intronic
1138632834 16:58312694-58312716 CTCCATCTTTAATAGGGGCTGGG - Intronic
1138815931 16:60202725-60202747 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1138851617 16:60636245-60636267 ATCCATCTTGAATAGGCGCGAGG + Intergenic
1138925915 16:61591231-61591253 CTCCATCTTGAATAGGGGAAGGG + Intergenic
1138944182 16:61827961-61827983 CTCCATCTTGAATAGGGGTTAGG + Intronic
1138980126 16:62257989-62258011 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1138980264 16:62259294-62259316 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1138995590 16:62448817-62448839 CTCCATCTTGAATAGCTGCTGGG + Intergenic
1139204821 16:65017242-65017264 CTCCATCTTGAGTAGGGGCTAGG - Intronic
1139267964 16:65657330-65657352 CTCCAAATTAAATGGGAGCCTGG + Intergenic
1139280321 16:65764959-65764981 CTCCATCTTGAATAGGACCTGGG + Intergenic
1139656551 16:68390733-68390755 CTCCATCTTGAATAGGTGCTGGG - Intronic
1139671983 16:68498407-68498429 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1139677137 16:68531485-68531507 CTCCATCTTAAATAGGAGCTAGG - Intronic
1139737672 16:69005831-69005853 CTCCACCTTGAATAGGGGCTGGG - Intronic
1139853986 16:69966304-69966326 CTCCATCTTGAGTAGGCGCTGGG + Intergenic
1139858853 16:70004030-70004052 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1139882967 16:70189217-70189239 CTCCATCTTGAGTAGGCGCTGGG + Intergenic
1139885972 16:70207182-70207204 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1140017292 16:71199865-71199887 CTCCATCTTGAGTAGGAGCTGGG + Intronic
1140023648 16:71263451-71263473 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1140369542 16:74406302-74406324 CTCCATCTTGAGTAGGCGCTGGG - Intergenic
1140455642 16:75103976-75103998 CTCCATCTCAAATAAAAGCGGGG + Intronic
1140641380 16:76977478-76977500 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1140666631 16:77233984-77234006 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1140717465 16:77739671-77739693 CTCCATCTTGAATAGGGGCTGGG - Intronic
1140793678 16:78415507-78415529 CTCCATTTTGAATAGGGGCTGGG - Intronic
1140995032 16:80250827-80250849 CTCCATCTTGAATAGGTGCTGGG + Intergenic
1141223601 16:82094220-82094242 CTCCATCTTGAATAGGGGCTGGG - Intronic
1141277935 16:82604972-82604994 CTCCATCTTGAATAGGGACTAGG + Intergenic
1141387258 16:83633234-83633256 CTCCATCTTGAATAGGAGCTGGG - Intronic
1141403166 16:83768971-83768993 CTCCATCTTGAATAGGAGCTGGG - Intronic
1141403442 16:83770941-83770963 CTCCATCTTGAATAGGTGCTGGG - Intronic
1141407391 16:83806642-83806664 CTCCATCTCGAATAGGAGCTGGG + Intergenic
1141915763 16:87095567-87095589 CTCCGTCTTGAGTAGGAGCTGGG - Intronic
1141973475 16:87497737-87497759 CTCCACTTTAAATAAGACCCCGG - Intergenic
1142519123 17:492807-492829 CTCCATCTTGAATAGCAGCTGGG - Intergenic
1143036492 17:4002632-4002654 CTCCATTTTGAATAGGGGCTGGG - Intergenic
1143906392 17:10212489-10212511 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1144014089 17:11177272-11177294 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1144016192 17:11198776-11198798 CTCCATCTTGAATAGGAGTTGGG + Intergenic
1144144368 17:12382887-12382909 CTCCATTTTGAATAGGGGCTGGG - Intergenic
1144273126 17:13639005-13639027 CACCATCTTGAATAGGGGCTGGG + Intergenic
1144281079 17:13727119-13727141 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG + Intronic
1144637793 17:16921610-16921632 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1144706425 17:17371322-17371344 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1144846617 17:18223374-18223396 CTCCATCTTGAATAGGAGGTGGG - Intergenic
1144923421 17:18782966-18782988 CTCCATCTTCAATAGGAGCTGGG - Intronic
1145114222 17:20193368-20193390 CTCCATCTTGAATAGGAGCTGGG - Intronic
1145244413 17:21258812-21258834 CTCCATCTTGTATAGGGGCTGGG + Intergenic
1145288977 17:21528218-21528240 CTCCATCTTGAATAGGGGCTGGG - Intronic
1145768710 17:27477322-27477344 CTCCGTCTTAAACAGGAGCTGGG - Intronic
1145782945 17:27575632-27575654 TTCCATCTTGAATAGGGGCTGGG - Intronic
1145829959 17:27908109-27908131 CTCCATCTTGAATAGGTGCTGGG + Intergenic
1146291257 17:31609009-31609031 CTCCATCTTGAATAGGGTCTGGG - Intergenic
1146295000 17:31642502-31642524 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1146694835 17:34900808-34900830 CTCCATCATGAATAGGAGATGGG + Intergenic
1146915912 17:36678277-36678299 TTCCATCTTGAATAGGAGGTGGG - Intergenic
1146935722 17:36811516-36811538 CTGCATGTTAAATAGCAGGCGGG - Intergenic
1147052359 17:37804906-37804928 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1147361740 17:39935135-39935157 CTCCGTCTTAAATAGAAGCTGGG - Intergenic
1147720228 17:42535477-42535499 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1148224030 17:45885725-45885747 GTCCTTCTTAATGAGGAGCCAGG + Intergenic
1148626986 17:49077041-49077063 CTCCATCTTGAATAAGTGCTGGG - Intergenic
1148652890 17:49262265-49262287 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1148814791 17:50319803-50319825 CTCCATCTTGAATAGGGGCCGGG - Intergenic
1148933983 17:51149955-51149977 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1149044055 17:52223977-52223999 CTCCATCTTGAATAGGAGCTCGG - Intergenic
1149104361 17:52944047-52944069 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1149106419 17:52972878-52972900 CTTCATCTTAAATAGGAGCTGGG - Intergenic
1149212034 17:54314988-54315010 CTCCATCTTAAATAGTGGCTGGG - Intergenic
1149213178 17:54326690-54326712 CTCCATCTTGAACAGGGGCTTGG - Intergenic
1149483715 17:57024423-57024445 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1149727942 17:58915545-58915567 CTCCATCTTGAATAGGGGTTGGG - Intronic
1149753445 17:59167989-59168011 CTCAATCTTGAATAGGAGCTGGG - Intronic
1150125913 17:62634778-62634800 CTCCATCTTTAAAAGGGGCTGGG - Intronic
1150173528 17:63024617-63024639 CTCCATCTTGAATAGGGGCTGGG - Intronic
1150348782 17:64425398-64425420 CTCCATCTTGAGTAGGAGTTGGG - Intergenic
1150350041 17:64437285-64437307 CTCCATCTTGAACAGGGGCTAGG + Intergenic
1150447155 17:65235377-65235399 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1150511650 17:65758892-65758914 CTCCATCTTGAATAGGGGATGGG + Intronic
1150609442 17:66721891-66721913 CTCCATCTTGAATAGCAGCTGGG - Intronic
1150680224 17:67278544-67278566 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1150680972 17:67284254-67284276 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1150844222 17:68638751-68638773 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1150906406 17:69342800-69342822 CTCCATCTCGAATAGGAGCTCGG - Intergenic
1150957267 17:69872842-69872864 CTCCATCTTGAATAGGAGGTGGG - Intergenic
1151014802 17:70542038-70542060 CTCCATCTTGAGTAGGGGCTAGG + Intergenic
1151052159 17:70990595-70990617 CTTCATCTTGAATAGGGGCTGGG - Intergenic
1151082106 17:71341210-71341232 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1151159041 17:72149465-72149487 CTCCATCTTGAATGGGAGCTGGG - Intergenic
1151224635 17:72639574-72639596 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1151417831 17:73978069-73978091 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1151831622 17:76555706-76555728 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1151838745 17:76602115-76602137 CTCCATCTTGAATAGGGACTGGG - Intergenic
1151865257 17:76797698-76797720 CTCCAACTTAAATAGGGGCTGGG - Intergenic
1151894665 17:76972004-76972026 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1151901287 17:77017077-77017099 CTCCATCTTGGATAGGGGCTGGG - Intergenic
1151911719 17:77087983-77088005 CTCCATCTTGAATAGGGGCTGGG - Intronic
1152314873 17:79574220-79574242 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1152997161 18:418463-418485 CTCCATCTTAAATAGGAGCTGGG + Intronic
1153048055 18:874439-874461 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1153148382 18:2059076-2059098 CTCCATCTTGACTAGGGGCTGGG - Intergenic
1153415084 18:4837646-4837668 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1153888997 18:9495121-9495143 CTCCATCTTGAATAGGGGCTGGG - Intronic
1154155575 18:11941693-11941715 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1154463606 18:14621044-14621066 CTCCATCTTAAACAGGAGCTAGG - Intergenic
1154489027 18:14904848-14904870 CTCCATCTTGAATAGGGGCATGG + Intergenic
1155157370 18:23168894-23168916 CTCCTTCTTAAATAGGAGCTGGG + Intronic
1155286828 18:24297907-24297929 CTCCATCTTAAACAGGAGCTGGG + Intronic
1155452087 18:25974090-25974112 CTCCATCTTGAATAGGAACTGGG - Intergenic
1155452321 18:25976052-25976074 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1155720326 18:29003095-29003117 CTCCATCTTAAATAGAAGCTGGG - Intergenic
1155850613 18:30769517-30769539 CTCCATCTTCAATAGAAGCTGGG + Intergenic
1156291199 18:35749879-35749901 CTCCATCTTGAATAGGGGCCAGG - Intergenic
1156815954 18:41311361-41311383 CTCCATCTTAAATAGGAGCTTGG - Intergenic
1157356845 18:46943285-46943307 CTCAATCTTGAATAGAAGCTGGG + Intronic
1157611903 18:48962439-48962461 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1157649439 18:49313033-49313055 CTCCATCTTGAATAGGAGCTAGG + Intronic
1157654719 18:49373668-49373690 CTCCATCTTGAATAGGAGCTGGG - Intronic
1157792426 18:50544605-50544627 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1158042126 18:53107150-53107172 CTCCATCTTGAATAGGGGCTGGG - Intronic
1158122962 18:54070469-54070491 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1158291322 18:55948127-55948149 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1158411704 18:57211277-57211299 CTCCATCTTGTATAGGGGCTGGG - Intergenic
1158560379 18:58508339-58508361 CTCCATCTTGAATAGGAGCTGGG + Intronic
1158571805 18:58602664-58602686 CTCCATCTTGAATAGGGTCTGGG + Intronic
1158709762 18:59827160-59827182 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1158722276 18:59936035-59936057 TTCCATCTTAAATAGGGGCTGGG - Intergenic
1158783502 18:60680134-60680156 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1158863395 18:61615100-61615122 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1158990507 18:62863914-62863936 CTCCATCTTGAATAGGGGCTGGG - Intronic
1159152693 18:64540193-64540215 CTCCATCTTGAATAGGGGTTAGG - Intergenic
1159437582 18:68438776-68438798 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1159447260 18:68556204-68556226 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1159585584 18:70280782-70280804 CTCTATCTTGAATAGGGGCTAGG - Intergenic
1159602892 18:70445610-70445632 GTCCATCGTGAATAGGAGCTGGG + Intergenic
1159675951 18:71284566-71284588 CTCCATCTTGACTAGGAGCTGGG + Intergenic
1159676123 18:71286206-71286228 CTCCATCTTGAATAGGATCTGGG - Intergenic
1159864787 18:73691277-73691299 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1159916133 18:74189408-74189430 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1160102596 18:75937014-75937036 CTCCATTTTGAATAGGAGCTGGG - Intergenic
1160185295 18:76671929-76671951 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1160318315 18:77868143-77868165 CTCCATATTGAATAGGAACTGGG - Intergenic
1160486154 18:79294673-79294695 CTCCATGTTAAACAGAAGTCAGG - Intronic
1161131062 19:2588933-2588955 CTCCATCTTAAAGAAGAGAAAGG - Intronic
1161190801 19:2954241-2954263 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1161243875 19:3238244-3238266 CTCCATCTTGAATAGGAGCTTGG - Intronic
1161602519 19:5193240-5193262 CTCCATCTTGAATAGGAGTTGGG - Intronic
1161713173 19:5861417-5861439 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1161814666 19:6492608-6492630 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1161870507 19:6866078-6866100 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1162149108 19:8632327-8632349 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1162941026 19:14009287-14009309 CTCCATCTTGAACAGGAACTGGG + Intergenic
1163164479 19:15486000-15486022 CTCCATCTTGAACAGGAGCTGGG - Intronic
1163211020 19:15840341-15840363 CTCCTTCTTGAATAGGAGCTGGG - Intergenic
1163357144 19:16821256-16821278 CTCCATCTAGAATAGGGGCTGGG + Intergenic
1163434447 19:17286887-17286909 CTCCACCTGGAATAGGAGCTGGG + Exonic
1164204032 19:23043154-23043176 CTCCATCTCAAAAAGTAGCTGGG + Intergenic
1164469977 19:28522120-28522142 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1164470674 19:28528677-28528699 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1164518606 19:28958948-28958970 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
1164713906 19:30377873-30377895 CTCCATCTTGAATAGGAGCTGGG - Intronic
1164770428 19:30804160-30804182 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1164900581 19:31917806-31917828 CTCCATCTCGAATAGGAGCTGGG - Intergenic
1164915612 19:32050068-32050090 CTCCATCTTGAATGGGGGCTGGG + Intergenic
1164942287 19:32260298-32260320 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1164942735 19:32264139-32264161 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1165122187 19:33567282-33567304 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1165127085 19:33605892-33605914 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1165131805 19:33637309-33637331 CTCCATCTTGAATAGGGGCTGGG - Intronic
1165181683 19:33977077-33977099 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1165267675 19:34675435-34675457 CTCCATCTTGAATAGGGCCTGGG + Intronic
1165318172 19:35069404-35069426 CTCCATCTTAAATAGGACCTGGG - Intergenic
1165340076 19:35205171-35205193 CCCCATCTTGAGTAGGGGCCAGG - Intergenic
1165599101 19:37037616-37037638 GTCCACCTGAAACAGGAGCCTGG - Intronic
1166321245 19:42020484-42020506 CTCCATCTTGAATAGGAGCTGGG + Intronic
1166459137 19:42970658-42970680 CTGCATCTTGAATAGGAGCAGGG + Intronic
1166476085 19:43125925-43125947 CTGCATCTTGAATAGGAGCAGGG + Intronic
1166805202 19:45482546-45482568 CTCCATCTCAAAAAAAAGCCGGG - Intergenic
1167091194 19:47345137-47345159 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1167335401 19:48882292-48882314 CTCCATCTTGAACAGGGGCTGGG + Intronic
1167730453 19:51250526-51250548 CTCCGTCTTGAATAGGAGCTGGG - Intronic
1167735475 19:51292068-51292090 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1167806140 19:51787145-51787167 CTCCATGTTGAATAGTAGCTGGG + Intronic
1168382699 19:55937818-55937840 CTCCATCTTGAAAATGAGCTGGG + Intergenic
1168433682 19:56301642-56301664 CTCCGTCTTGAATAGGGGCTGGG - Intronic
1168549131 19:57278793-57278815 CTCTATCTTAAATAGGAGCTGGG - Intergenic
1168658648 19:58148926-58148948 CTCCATCTTAAATGGGGACTGGG + Intronic
924984125 2:253230-253252 CTCCATTTTGAATAGGAGCTGGG + Intronic
925892497 2:8446969-8446991 CTCCATCTTGAATAGGAGCTGGG - Intergenic
926126583 2:10276146-10276168 CTCCATCTTGAATAGCGGCTGGG - Intergenic
926129879 2:10296308-10296330 CTCCATCTTGAGGAGGAGCTGGG - Intergenic
926245949 2:11122616-11122638 CTCCATCTTGCGTAGGAGCTGGG - Intergenic
926340420 2:11900542-11900564 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
926360694 2:12083895-12083917 CTCCATCTTGAATAGGGACTGGG + Intergenic
926406440 2:12557845-12557867 CTCCATCTTGAGTAGGGGGCGGG - Intergenic
926642434 2:15251897-15251919 CTCCATCTTGAATAGGAGCTGGG - Intronic
926959728 2:18343040-18343062 CTCCATCTTAAACAGGAGCTGGG + Intronic
927574925 2:24192950-24192972 CTCCATCTTAAATAGGAGCTGGG - Intronic
927686604 2:25175428-25175450 CTCCATCTTGAATAGGGACTGGG + Intergenic
927892143 2:26758255-26758277 CTCTATCTTGAATAGGGGCTGGG - Intergenic
927892535 2:26761097-26761119 CTCCATCTTGAACAGGGGCTGGG + Intergenic
927911434 2:26902647-26902669 CTCCATCTTAAATAGGGGCTGGG + Intronic
927970300 2:27301779-27301801 CTCCATCTTGAATAGGGGCTGGG - Intronic
928237229 2:29554685-29554707 CTCCATCTTGAATAGGGTCTGGG + Intronic
928348287 2:30520913-30520935 ATCCATCTTAAATAGGAGCTGGG + Intronic
928439728 2:31282245-31282267 CTCCATGTTAAATAGGAGCTGGG + Intergenic
928683962 2:33728729-33728751 CTTCATCTTGAATAGGAGCTGGG + Intergenic
928700536 2:33894635-33894657 CTCCATCTTGAATAGGGGCTGGG + Intergenic
929060383 2:37918018-37918040 CTCCATCTTGAATAGGGGCTGGG - Intergenic
929221391 2:39468206-39468228 CTCCATCTTGAATAGGAGCTGGG + Intergenic
929232374 2:39572979-39573001 CTCCATCTTGAATAGGGGCTGGG - Intergenic
929551035 2:42892092-42892114 CTCCATCTTGAATAAGGGCTGGG - Intergenic
929987848 2:46754101-46754123 CCCCATCTTGAATAGGGGCTGGG - Intronic
930062027 2:47297985-47298007 CTCCATCTTAAGTAGGGGCTGGG + Intergenic
930117179 2:47728182-47728204 CTCCATCTTGAATAGGGGCTGGG - Intronic
930157356 2:48119127-48119149 CTCCATCTTGAATAGGAGGCGGG + Intergenic
930369211 2:50482649-50482671 CTCCATCTTGAATAGGGGCTGGG + Intronic
930414822 2:51078105-51078127 CTCCATCTTGAATAGGAGCTAGG + Intergenic
930563622 2:52992052-52992074 CTACATCTTAAAGAGCAGCATGG - Intergenic
930576704 2:53159344-53159366 TTCCATTTTGAATAGGAGCTGGG + Intergenic
930604911 2:53483735-53483757 CTCCATCTGGAATAGGGGCTGGG + Intergenic
930625824 2:53696921-53696943 CTCCATCTTGAATAGGGGCTAGG + Intronic
930673924 2:54179863-54179885 TTCCATCTTGAATAGGAGCTGGG - Intronic
930797495 2:55408333-55408355 CTCCATCTCGAATAGGGGCTAGG + Intronic
931100305 2:58991808-58991830 CTCCATCTCGAATAGGAGCTAGG - Intergenic
931143657 2:59491372-59491394 CTCCATCTTGGATAGGAGCTGGG - Intergenic
931368517 2:61640504-61640526 CTCCATTTTGAATAGGGGCTGGG + Intergenic
931386710 2:61804383-61804405 CTCCATCTTGAAAAGGAGCTGGG - Intergenic
931521015 2:63097634-63097656 CTCCATCTTGAATAGGAGCTGGG + Intergenic
931541630 2:63335727-63335749 CTCCATCTTAAATAGGAACTGGG + Intronic
932076825 2:68672142-68672164 CTCCATCTTGAATAGGGGCTGGG - Intergenic
932827424 2:74954711-74954733 CTCCATCTTGAATAGGAGCTGGG + Intergenic
932860776 2:75289131-75289153 CTCCATCTTGAATAGGAACTGGG + Intergenic
933228772 2:79781453-79781475 CTCCATCTTGAATAGGAGCTGGG - Intronic
933407624 2:81881303-81881325 CTCCATCTTGAATAGGGGCTGGG + Intergenic
933427313 2:82129494-82129516 CTCCATCTTGAATAGGAGCTAGG + Intergenic
933427569 2:82132110-82132132 CTCCATCTTGAATAGGAGCTAGG + Intergenic
933457956 2:82541047-82541069 CTTCATCTTAAATAGGGGCTGGG - Intergenic
933473805 2:82763676-82763698 CTCCATCTTGAGTAGGGACCAGG + Intergenic
933580985 2:84126531-84126553 GTCCCTCTGAAAGAGGAGCCTGG - Intergenic
933613990 2:84464912-84464934 TTCCATCTTAAATAAGAGCTGGG - Intergenic
934028270 2:88018551-88018573 TTCCATCTTGAATAGGCGCTGGG - Intergenic
934029180 2:88026411-88026433 CTCCATCTTGAATAGGAGCTGGG + Intergenic
934697813 2:96412774-96412796 CTCCATCTTGACTAAGAGCTGGG + Intergenic
934773368 2:96921876-96921898 CTCCATCTTGAATAGGGGCTGGG + Intronic
934888550 2:98046182-98046204 CTCCATCTGAAATAGGAGCTGGG + Intergenic
934889371 2:98053457-98053479 CTCCATCTGAAATAGGAGCTGGG + Intergenic
935095458 2:99940328-99940350 CTCCATCTTGAATAGGAGCTGGG + Intronic
935115008 2:100127821-100127843 CTCCATCTTGAATAGGAGCTGGG + Intronic
935471831 2:103469995-103470017 CTCCATCTTGAATAAGTGCTGGG - Intergenic
935472934 2:103480962-103480984 CTCCATCTTGAATAAGGGCTAGG - Intergenic
935596826 2:104885314-104885336 CTCCATCTTGAATAGAGGCTGGG + Intergenic
935597086 2:104887341-104887363 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
935636999 2:105256715-105256737 CTCCATCTTGAATAAGAGCTGGG + Intergenic
935661128 2:105467852-105467874 CTCCACCTTGAATAGAAGCTGGG + Intergenic
935743038 2:106167759-106167781 CTCCATCTTGAACAGTAGCTGGG + Intronic
935784036 2:106532933-106532955 CTCCATCTTGAATAGGGTCTGGG - Intergenic
936087142 2:109477104-109477126 CTCCATCTTGAGTAGGGGCTAGG - Intronic
936429692 2:112451489-112451511 CTCCATATTGAATAGGGGCTGGG - Intergenic
936470221 2:112791974-112791996 TTCCATCTTGAATAGGGGCTGGG + Intergenic
936515624 2:113179683-113179705 CTCCATCTTGAATAGGGGCTGGG - Intronic
936819116 2:116497352-116497374 CTCCATCTTGAATAGAGGCTGGG + Intergenic
937514339 2:122636878-122636900 CTCCATCTTAAAGAGGAGCTTGG + Intergenic
937537349 2:122906420-122906442 CTCCATCTTGAATAGGGGCTGGG - Intergenic
938092686 2:128443769-128443791 CTCCATCTTGAATAGGGGCTGGG - Intergenic
938238990 2:129728514-129728536 CTTCATCTTCAATAGGAGCTGGG - Intergenic
938781548 2:134589265-134589287 CTCCATCTTGAATAGGGGCTGGG + Intronic
938781837 2:134591549-134591571 CTCCATCTTTAATAGGGGCTGGG - Intronic
938850738 2:135256694-135256716 CTCCATCTTGAACAGGGGCAGGG + Intronic
939047685 2:137268785-137268807 CTCCATCTTGAATAGGGGCTGGG - Intronic
939253684 2:139716068-139716090 TTCCATCTTGAATAGGGGCTTGG - Intergenic
939286354 2:140135706-140135728 CTCCATCTTTAATGGGGGCTAGG - Intergenic
939292327 2:140212209-140212231 CTCCATCTTTAATAGGGGCTGGG - Intergenic
939537928 2:143455511-143455533 CTCCATCTTGAATAGCGGCTGGG - Intronic
939736539 2:145854244-145854266 CTCCATCTTGAATAGGGGGTGGG + Intergenic
939843533 2:147217045-147217067 CACCATCTTGAATAGGGGCTGGG - Intergenic
939843999 2:147221488-147221510 CACCATCTTGAATAGGAACTGGG - Intergenic
940040981 2:149360382-149360404 CTCCATCTTGAATAGGGGCTGGG - Intronic
940134271 2:150418186-150418208 CTCCATCTTGAATCAGAGCTGGG - Intergenic
940172733 2:150846152-150846174 CTCCATCTTGAATAGGGGCTGGG - Intergenic
940184891 2:150972826-150972848 TTCTATCTTGAATAGGAGCTGGG - Intergenic
940209853 2:151245160-151245182 CTCCATCTTGAATAGGAGCTGGG - Intergenic
940313447 2:152303521-152303543 CTCCAAGATGAATAGGAGCCTGG + Intergenic
940313477 2:152303793-152303815 CTCCATCTTGAATAGGGGCTGGG + Intergenic
940654345 2:156470082-156470104 CTCCATCTTGAATAGGAGCTGGG - Intronic
940726290 2:157340401-157340423 CTGCATCTTAAATAGGAGCTGGG - Intergenic
940982871 2:160023183-160023205 CTCCATCTTGTTTAGGAGCTGGG + Intronic
941395041 2:164963854-164963876 CTCCATCTTGAATAGGGGCTGGG + Intergenic
941584144 2:167335899-167335921 TTCCATCTTGAATAGGGGCTGGG - Intergenic
941706600 2:168664884-168664906 CTCCATCTTAAATAGGAGCTGGG - Intronic
941876816 2:170441989-170442011 CTTCATCTTGAATAGGGGCTGGG - Intronic
942066309 2:172274920-172274942 CTCCATCTTTAATAGGAGCTGGG - Intergenic
942078846 2:172381825-172381847 CTCCATCTTGAATAGGAGCTGGG + Intergenic
942127282 2:172839695-172839717 CTCCATCTTAAATAGGAACTGGG - Intronic
942177909 2:173352852-173352874 CTCCATCTTGAATAGGAGCTGGG + Intergenic
942194624 2:173505234-173505256 CTCCATCTTGAATAGGAGCTGGG - Intergenic
942314610 2:174685875-174685897 CTCCACCTTAAATAGGAGCTGGG - Intergenic
942589001 2:177520253-177520275 CTGCATCTTAAATAGGAGCTGGG - Intronic
942925825 2:181430802-181430824 CTCCATCTTGAATAGGGGCTGGG - Intergenic
943466417 2:188234888-188234910 CTCCATCTTGAATAGGAGCTGGG + Intergenic
943466971 2:188240094-188240116 CTCCATCTTAAATAGGAGCTGGG + Intergenic
943733066 2:191323361-191323383 CTCCATCTTGAATAGGGACTGGG - Intronic
943760185 2:191599667-191599689 CTCCATCTTGAATAGGGGTTGGG + Intergenic
943895143 2:193347896-193347918 CTCCATCTTAAATAGGAGCTGGG - Intergenic
943991903 2:194706453-194706475 CTCCATCTTGAATAGGAGCTGGG - Intergenic
944042320 2:195369399-195369421 CTCCATCTTGAATAGGGGCTGGG - Intergenic
944198977 2:197085381-197085403 CTCCATCTTGAATAAGGGCTGGG + Intronic
944476075 2:200108022-200108044 CTCCATCTTGAATAGGGGCTGGG - Intergenic
944714235 2:202362691-202362713 CTCCATCTTAAATAGGGGCTGGG - Intergenic
944898214 2:204187709-204187731 CTCCATCTTGAATAGGGGCTGGG - Intergenic
944928005 2:204485086-204485108 CTCTGTCTTGAATAGGAGCTGGG + Intergenic
945382322 2:209155799-209155821 CTTCATCTTGAATAGGGGCTGGG + Intergenic
945398964 2:209356054-209356076 CTCCATCTTGAATAAGAGTTAGG + Intergenic
945736830 2:213611046-213611068 CTCCATCTTGAGTGGGAGCTAGG - Intronic
945907858 2:215614952-215614974 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
945937345 2:215916369-215916391 CTCCATCTTGAATAGGAGGTGGG + Intergenic
945985188 2:216347958-216347980 CTCCATCTTGAATAGGGGCTGGG + Intronic
946040700 2:216780968-216780990 CTCCATCTTAAAAATAAGCAGGG - Intergenic
946110311 2:217409138-217409160 CTCCATCTTGAATAGGAGCTGGG - Intronic
946114468 2:217449233-217449255 CTCCATCTTAAATAGGAACTGGG - Intronic
946461880 2:219876130-219876152 CTCCGTCTTAAATAGGGGCTGGG + Intergenic
946462001 2:219877060-219877082 CTCCATCTTGAATAGGGGCTGGG + Intergenic
946462175 2:219878451-219878473 CTCCATCTTGAAAAGGGGCTGGG + Intergenic
946730551 2:222705370-222705392 CTCCATCTTGAATAGGGGCTGGG - Intronic
946781609 2:223197286-223197308 CTGCATCTTGAATAGGGGCTGGG - Intronic
946809984 2:223513350-223513372 CTCCATCTTCCATAGGCACCAGG - Intergenic
946845398 2:223854399-223854421 CTCCATCTTGAATAGGGGCTGGG + Intergenic
946893958 2:224303968-224303990 CTCCATCTTGAACAGGATCTGGG - Intergenic
947088635 2:226484786-226484808 CTCCATCTTGAATAGGGGCTGGG + Intergenic
947097303 2:226580587-226580609 CTCCATCTTGAATAGGGGCTGGG - Intergenic
947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG + Intergenic
947975788 2:234364653-234364675 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
947984088 2:234434563-234434585 CTCCATCTTGAATAGGGGCTGGG + Intergenic
948019988 2:234724184-234724206 CTCCATCTTGAATAGGGGCTGGG - Intergenic
948094345 2:235321579-235321601 CTCCATCTTGAACAGGAGCTGGG + Intergenic
948109548 2:235443738-235443760 CTCCATCTTGAATAGGAGCTGGG + Intergenic
948329332 2:237152582-237152604 CTCCATCTTGAAGAGGGGCTGGG + Intergenic
948933327 2:241146712-241146734 CTACTTCTTAAATAAGAGACTGG + Intronic
1168825839 20:813226-813248 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1168880464 20:1202206-1202228 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1168975746 20:1964574-1964596 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1169007817 20:2223475-2223497 CTCCATCTTGAATCGGGGCTGGG + Intergenic
1169044178 20:2522917-2522939 CTCCATCTTGAATAGGGGCTGGG + Intronic
1169273637 20:4218702-4218724 CTCCATCTTAAATAGGGGCTGGG + Intergenic
1169389820 20:5180724-5180746 CTCCATCCTGAATAGGAGCTGGG - Intronic
1169441172 20:5635109-5635131 CTCCATCTTGAATATGAGCTGGG + Intergenic
1169565836 20:6852660-6852682 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1170635011 20:18096630-18096652 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1171135820 20:22693597-22693619 CTTCATCTTAAACAGGAGCTGGG - Intergenic
1171171620 20:23020454-23020476 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1171306943 20:24114828-24114850 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1171327526 20:24308661-24308683 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1171962667 20:31506054-31506076 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
1172035270 20:32006211-32006233 CTCCATCTTGAATAGAAGCTAGG - Intergenic
1172362230 20:34321228-34321250 CTCCATCTTAAAGAGGAAATGGG + Intergenic
1172362429 20:34322931-34322953 CACCATCTTGAATAGGGGCTGGG + Intergenic
1172367001 20:34357790-34357812 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1172585761 20:36083291-36083313 CTCCATCTTGAGTAGGTGCTAGG + Intergenic
1172798443 20:37559494-37559516 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1172813034 20:37664023-37664045 CTCCATCTTAAACAGGAGCTGGG - Intergenic
1172887877 20:38243769-38243791 CTCCATCTGAAATAAGAGCATGG - Intronic
1173357500 20:42307737-42307759 CTCCATCTTGAATAGGGGCTGGG + Intronic
1173357948 20:42312915-42312937 CTCCATCTTAAATAGGACCTGGG + Intronic
1173492559 20:43494931-43494953 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1173532671 20:43782458-43782480 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1173661319 20:44735958-44735980 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1173731436 20:45331450-45331472 CTACATCTTGAATAGGGGCTGGG + Intronic
1173746702 20:45443012-45443034 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1173906847 20:46635652-46635674 CTCCATCTTGAACAGGAGCTGGG + Intronic
1174102751 20:48139724-48139746 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1174122603 20:48277467-48277489 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1174122740 20:48278956-48278978 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1174143363 20:48432703-48432725 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1174297395 20:49558639-49558661 CTCCATGTTGAATAGGAGCTGGG + Intronic
1174323805 20:49763095-49763117 CTCCATCTGGAATAGGGGCTGGG - Intergenic
1174516070 20:51093365-51093387 CTCCATCTTGAATAGGGGCGGGG + Intergenic
1174547825 20:51339132-51339154 CTCCATCTTGAATAGGGGCCGGG - Intergenic
1174608367 20:51778236-51778258 CTCCATCTCGAACAGGAGCTGGG + Intergenic
1174899135 20:54480175-54480197 CTCCATCTTGAATAGGAGCTGGG + Intronic
1174916737 20:54661396-54661418 CTCCATCTTGAATACGAGCTGGG - Intergenic
1175010398 20:55728810-55728832 CTCTATCTTGAATAGGAGCTGGG + Intergenic
1175027573 20:55918827-55918849 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1175097343 20:56552050-56552072 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1175137167 20:56832912-56832934 CTCCATGTTGAATAGGAGATGGG - Intergenic
1175144714 20:56886761-56886783 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1175181505 20:57151361-57151383 TTCCATCTTAAACGGGAGCTGGG - Intergenic
1175481116 20:59311782-59311804 CTCTATCTTGAATAGGGGCTGGG - Intronic
1175635342 20:60578249-60578271 CTCCATCTTGATTAGGGGCTGGG - Intergenic
1176291805 21:5049738-5049760 CTCCATCTTAAATAGGCACTGGG - Intergenic
1176298934 21:5089307-5089329 CTCCGTCTTGAATAGGGGCTGGG + Intergenic
1176810918 21:13537328-13537350 CTCCATCTTAAACAGGAGCTAGG + Intergenic
1177174613 21:17690266-17690288 CTCCATCTTGAATGGGGGCTAGG + Intergenic
1177432483 21:21007883-21007905 CTCCATCTTGAATAGCATCTGGG - Intronic
1177510048 21:22075106-22075128 CTCCGTCTTGAATAGGGGCTGGG + Intergenic
1177536530 21:22434882-22434904 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1177684175 21:24416128-24416150 CTCCATCTTAAATAAGAGCTAGG + Intergenic
1177799196 21:25810787-25810809 CTTCACCTTAAATAGGAACCAGG - Intergenic
1177806299 21:25878382-25878404 CTCCATTTTGAATAGGGGCTGGG + Intergenic
1178043991 21:28673934-28673956 CTCCATCTTAAATAGAAGCTGGG + Intergenic
1178055282 21:28791781-28791803 CTCCATCTTGAATAGGGGACGGG + Intergenic
1178113000 21:29387776-29387798 CTCCATCTTAAATAGGGGCTGGG - Intronic
1178171678 21:30048491-30048513 CTCCATCTTGAATAGCAGCTGGG + Intergenic
1178179493 21:30143803-30143825 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1178202075 21:30418740-30418762 CTCCATCTTGAATAGGAGCTGGG + Intronic
1178280335 21:31277061-31277083 CTCCATCTTAAATAGGAGCTGGG + Intronic
1178436077 21:32559432-32559454 CTCCATCTTGAATAAGGGCTTGG - Intergenic
1178469837 21:32882689-32882711 ATCCATCTTGAATAGGGGCTGGG - Intergenic
1178477349 21:32948823-32948845 CTCCATCTTGAATGGGAGCTGGG + Intergenic
1178479151 21:32964066-32964088 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1178514491 21:33235302-33235324 CTCCATCTTGAGTAGCAGCTGGG - Intronic
1178522849 21:33300828-33300850 CTCCATCTTGAAGAGGGGCTGGG + Intergenic
1179255209 21:39709965-39709987 CTCCATCTTGAATAGAAGCTGGG - Intergenic
1179578708 21:42324112-42324134 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1179670156 21:42941268-42941290 CTCAATCTTGAATAGGGGCTGGG + Intergenic
1179673861 21:42968554-42968576 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1179796061 21:43784415-43784437 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1179807577 21:43849740-43849762 CTCCATCTTGAATCGGGGCTGGG - Intergenic
1179858092 21:44172642-44172664 CTCCGTCTTGAATAGGGGCTGGG - Intergenic
1179865451 21:44213903-44213925 CTCCATCTTAAATAGGCACTGGG + Intergenic
1180242461 21:46519371-46519393 CTCCATCTTGAATAGGGGCTAGG - Intronic
1180578355 22:16803426-16803448 CTCCATCTTAAACAGGAGCTAGG + Intronic
1180593343 22:16958485-16958507 CTTCATCTTAAATAGGAAATAGG - Intergenic
1180935742 22:19624206-19624228 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1181145197 22:20840906-20840928 CTCCATCCTGAATAGGGGCTGGG + Intronic
1181515039 22:23405409-23405431 CTCCATCTGAGATCGGGGCCTGG + Intergenic
1181641706 22:24204041-24204063 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1182521498 22:30887324-30887346 CTCCACCTTAAACAGGAGCTGGG - Intronic
1182538486 22:31024077-31024099 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1182644893 22:31800293-31800315 CTCCATCTTGAATAGGGGCTGGG - Intronic
1182939383 22:34260232-34260254 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1182943931 22:34304771-34304793 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1182985197 22:34709732-34709754 GTCCATCTTTAATAGGGGCTGGG + Intergenic
1183000152 22:34850259-34850281 CTCCGTCTTGAATAGGGGCTGGG + Intergenic
1183113242 22:35668726-35668748 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1183113732 22:35673470-35673492 CTCCATCTTGAACAGAGGCCGGG + Intergenic
1183207117 22:36426985-36427007 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1183325519 22:37189432-37189454 CTCCATCTTGAATAGGGGCTGGG - Intronic
1183326203 22:37196060-37196082 CTCCATCTTGAGTAGGAGCTGGG - Intronic
1183589579 22:38772044-38772066 CTCCATCTTGAATAGGAGCTGGG + Intronic
1183856855 22:40640450-40640472 CTCCATCTTAAATAGGGGCTGGG + Intergenic
1183938063 22:41275483-41275505 CTCCATCTTAAAAAAAAGTCAGG + Intronic
1184225133 22:43125349-43125371 CTCCATCTTGATTAGGGGCTGGG - Intronic
1184481009 22:44747305-44747327 CTCCATCTTGAATAGGGGCTGGG + Intronic
949094994 3:75283-75305 CTCTATCTTGAATAGGGGCTGGG - Intergenic
949098408 3:113921-113943 CTCCATCTTGAATAGGAGCTGGG + Intergenic
949282005 3:2356708-2356730 CTCCATCTTGAATAGGGGCTGGG - Intronic
949364503 3:3266454-3266476 CTCCATCTTGAATAGGGGCTGGG + Intergenic
949405172 3:3706391-3706413 CTGCATCTTGAATAGGAGCTGGG - Intronic
949405389 3:3708590-3708612 CTCCGTCTTAAATAGAGGCTGGG + Intronic
949439366 3:4064071-4064093 CTTCATCTTGAATAGGAGCTGGG + Intronic
949785293 3:7733644-7733666 CTCCATCTTGAATAGGGACTGGG - Intronic
949879490 3:8650156-8650178 TTCAATTTTAAATAGGGGCCAGG - Intronic
950018595 3:9770494-9770516 CTCCATCTTGCAGAGGAACCGGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
950781816 3:15398832-15398854 CTCCATCTTGAATAGGCGCTGGG + Intronic
952123618 3:30274636-30274658 CTCCATCTTAAATAATAGCTAGG + Intergenic
952124212 3:30280564-30280586 CTCCGTCTTAAATAAGAGCTGGG + Intergenic
952179929 3:30906869-30906891 CTCCATCTTGAATAGGGGCTGGG - Intergenic
952294330 3:32048082-32048104 CTCCATCTTTAATAGGGGCTGGG - Intronic
952294423 3:32048716-32048738 CTCCATTTTGAATAGGGGCTGGG + Intronic
952295288 3:32056765-32056787 CTCCATCTTGAAAAGGGGCTGGG + Intronic
952377102 3:32777006-32777028 CTCCATCTTAAATGGGAGCTGGG + Intergenic
952559132 3:34569016-34569038 TTCCATCTTGAATAGGGGCTGGG - Intergenic
952666190 3:35907068-35907090 CTCCATCTTAAATAGTAGTTAGG - Intergenic
952862436 3:37824564-37824586 CTCCATCTTGAATAGGGGCTGGG - Intergenic
953074880 3:39559170-39559192 CTCCATCTTGAATAGGGACTGGG - Intergenic
953320381 3:41966131-41966153 CTCCATCTCGAATAGGGGCTGGG + Intergenic
953416001 3:42718066-42718088 CTCCATCTTAAATAGGAGCTGGG + Intronic
953416437 3:42722377-42722399 CTCCATCTTAAAGAGGAGCTGGG + Intronic
953427615 3:42808132-42808154 CTCCATCTTGAATAGGGGCTAGG - Intronic
953521703 3:43649119-43649141 CTTCATCTTGAATAGGGGCTGGG - Intronic
953609784 3:44438017-44438039 CTCCATGTTGAATAGGGGCTGGG - Intergenic
953610222 3:44441480-44441502 CTCCATCTTGAATAGGGAACTGG - Exonic
953683940 3:45061311-45061333 CTCCATCTTGAATAGGGGCTGGG + Intergenic
953684414 3:45065221-45065243 CTCCATCTTGAATAGGGACTGGG - Intergenic
954078966 3:48201550-48201572 CTCCATCTTGAATCGGAGCTGGG + Intergenic
954482821 3:50817321-50817343 CTCCATCTTAAATAGGAGCTGGG - Intronic
954484311 3:50832646-50832668 CTCCATCTTGAATAGGGGCTAGG - Intronic
954936992 3:54335696-54335718 CTCCATCTTAAATAGGGGCTGGG - Intronic
954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG + Intronic
955006997 3:54978240-54978262 CTCCATCTTGAATAGGGGCTGGG - Intronic
955045864 3:55359092-55359114 CTGCATCTTGAATAGGAGCTGGG + Intergenic
955209136 3:56924878-56924900 CTCCATCTTGAATAGGAGCTGGG - Intronic
955380854 3:58436697-58436719 CTCCATCTTGAATAGGAGCTGGG - Intergenic
955381335 3:58440645-58440667 CTCCATCTTGAATAGGAGCTGGG - Intergenic
955416498 3:58696755-58696777 CTCCATCTTAAGCAGGAGCTGGG + Intergenic
955454571 3:59105645-59105667 CTTTATCTTAAACAGGAGCTGGG + Intergenic
955667821 3:61369072-61369094 CTCCTCCTTAGAAAGGAGCCAGG + Intergenic
955834863 3:63043808-63043830 CTCCCTCTTCAACAGGAGCTTGG + Intergenic
956117198 3:65930542-65930564 CTCCATCTTGAATAGGGGCTAGG + Intronic
956446180 3:69328461-69328483 CTCCATCTTGAATAGGACCTGGG + Intronic
956648547 3:71481429-71481451 CTACATCTTAACTTGGATCCTGG + Intronic
956690995 3:71877535-71877557 CTCCATCTTGAATAGGAGCTGGG - Intergenic
956907370 3:73780863-73780885 CTCCATCTTAATTAGTAGCTGGG + Intergenic
957218192 3:77348583-77348605 CTCCATCTTGAATAGGAGCTGGG - Intronic
957518365 3:81286304-81286326 CTCCATCTTGAATAGGGACAGGG + Intergenic
957539144 3:81546406-81546428 CTCCATCTTGAAGAGGGGCTGGG + Intronic
957893079 3:86384703-86384725 CTCCATCTTGAATAGGGACTAGG - Intergenic
958038001 3:88192472-88192494 CTCCATCTTGAATAGGGGCTGGG - Intergenic
959064626 3:101644016-101644038 CTCCATCTTGAATAGGGGCTGGG + Intergenic
959161657 3:102732037-102732059 CTCCATCTTGAATAGGGGCTGGG + Intergenic
959343239 3:105157911-105157933 CGCCACCTTGAATAGGAGCTGGG - Intergenic
959400226 3:105891821-105891843 CTTAATCTTAAAATGGAGCCGGG - Intergenic
959680969 3:109096244-109096266 CTCCATCTTGAACAGGGGCTGGG + Intronic
959811913 3:110629495-110629517 CTCCATCTTAAATAGGAGCTGGG - Intergenic
959872674 3:111346419-111346441 CTCCATCTTCAATAGGGGCTGGG - Intronic
959884250 3:111480251-111480273 CTCCATCTTGAATAGGGGCTGGG - Intronic
959989511 3:112615563-112615585 CTCCATCTTAAATAGGAGCTGGG + Intronic
960040963 3:113149486-113149508 CTCCATCTTGAAGAGGAGCTGGG + Intergenic
960069151 3:113409636-113409658 CTCCATCTGGAATAGGAGCTGGG + Intronic
960386264 3:117025510-117025532 CTCCATCTTAAATAGGAGCTGGG + Intronic
960387095 3:117033770-117033792 CTCCATCTTAAATAGGAGCTGGG + Intronic
960504714 3:118478841-118478863 CTCCACCTTGAATAGGAGCGGGG + Intergenic
960514586 3:118589667-118589689 CTCTATCTTAAGTAGGGGCTGGG + Intergenic
960515058 3:118594444-118594466 CTCTATCTTAAGTAGGGGCTGGG + Intergenic
960665021 3:120100189-120100211 CTCCATCTTAAACAGGAGCCGGG - Intergenic
960993643 3:123327471-123327493 CTGCATCTTAAAAAGGACCCCGG - Intronic
961510450 3:127398368-127398390 CTCCATCTTGAATAGGGGCTGGG - Intergenic
961689002 3:128654719-128654741 CTCCATCCTGAATAGGAACTGGG - Intronic
962095254 3:132286226-132286248 CTCCATCTTGAAAAGGGGCTGGG + Intergenic
962119263 3:132544700-132544722 CTCCACCTTGAATAGGGGCTGGG + Intergenic
962738053 3:138343462-138343484 CTCCAGCTTCATTAGGAGCTAGG - Intergenic
962747782 3:138410372-138410394 CTCCATCTTGAATAGGGGGCTGG - Intergenic
962749830 3:138425705-138425727 CTCCATCTTGAATAGGGGTTGGG - Intergenic
962795587 3:138847012-138847034 CTCCATTTTGAATAGGGGCTGGG + Intergenic
962907090 3:139813749-139813771 CTCCATCTTGAATAAGGGCTGGG - Intergenic
963037498 3:141045202-141045224 CTCCATCTTAGATAGGGGCTGGG - Intergenic
963439133 3:145314851-145314873 TTCAATCTTAAATAGAAGACTGG - Intergenic
963672776 3:148272481-148272503 CTCCATCTTGAATAGGGGCTGGG - Intergenic
963818939 3:149866618-149866640 CTCCATCTTGAATAGGAGCTGGG - Intronic
964281925 3:155077099-155077121 CTCCATCTTGAATAGGGGCCGGG - Intronic
964845325 3:161038779-161038801 CTCTATCTTAAATGGGAGCTGGG + Intronic
964987520 3:162762921-162762943 CTCCATCTTGAATAGGGGATGGG - Intergenic
965287296 3:166832929-166832951 CTCCATCTTAAACAGAAGCTGGG - Intergenic
965556904 3:170027876-170027898 CTCCATCTTGAATAGGGGCTGGG - Intergenic
965586269 3:170320777-170320799 CTCTATCTTAAATAGGAGCTGGG - Intergenic
965587890 3:170335107-170335129 CTCCATCTTAAATAGGAGCTGGG - Intergenic
966034916 3:175399803-175399825 CTGCATCTTCAACAGGAGCCGGG - Intronic
966489330 3:180509731-180509753 CTCCATCTTGAATAGGAGCTGGG + Intergenic
966721592 3:183068158-183068180 TCCCATCTTGAATAGGAGCTGGG + Intronic
967243561 3:187464878-187464900 CTCCATCTTGAATAGGAGCTGGG + Intergenic
967328862 3:188270173-188270195 CTGCATCTTTGATAGGAGCACGG + Intronic
967587900 3:191236855-191236877 CTCCATCTTGAATAGGGGCTGGG - Intronic
967960734 3:194921928-194921950 CTCCATCTTGAATAGGAGCTGGG + Intergenic
968081411 3:195849155-195849177 CTGCATCTTGAATGGGAGCTGGG - Intergenic
968115894 3:196089414-196089436 CGGCATGTTAAATAGGAGCTAGG - Intergenic
968155745 3:196379433-196379455 CTCCATTTTGAATAGGGGCTCGG - Intronic
968295903 3:197576427-197576449 CTCCATCTTGAATAGGGGCTGGG - Intergenic
968846187 4:3042865-3042887 CTCCATCTTGAATGGGGGCTGGG + Intergenic
968848116 4:3058647-3058669 CTTCATCTTGAATAGGGGCGGGG - Intergenic
968927132 4:3555445-3555467 CTCCATCTTGAACAGGAGCTGGG - Intergenic
969087854 4:4669807-4669829 CTCCATCTTGAATAGAGGCTGGG + Intergenic
969303505 4:6311270-6311292 CTCCATCTTGAATAGGAGATGGG + Intergenic
969303975 4:6314563-6314585 CTCCATCTTGAATAGGGGCTGGG + Intergenic
969420496 4:7091613-7091635 CTCCATCTTGAATAGGCGCTGGG - Intergenic
969614257 4:8243043-8243065 CTCCATCTTGAATGGGGGCTGGG + Intergenic
969634425 4:8358485-8358507 CTCCATCTTGAATATGAGCTGGG + Intergenic
969634986 4:8363606-8363628 CTCCATCTTGAATAGGAGCTGGG + Intergenic
969906928 4:10405827-10405849 CTCCATCTTAAATAGGAGCTGGG - Intergenic
970053763 4:11948045-11948067 CTCCATCTTAAATAGCAGCTGGG - Intergenic
970054041 4:11950941-11950963 CTCCATTTTAAATAGGAGCTGGG + Intergenic
970083260 4:12315111-12315133 CTTCATCCTGAATAGGAGCTGGG + Intergenic
970532320 4:16997262-16997284 CTCCATCTTGAATAGGAGCTGGG + Intergenic
970712272 4:18877085-18877107 CTCCATTTTGAATAGAAGCTGGG - Intergenic
970880601 4:20925243-20925265 CTCCATCCTAAATAGGAACTGGG + Intronic
970933801 4:21544945-21544967 CTCCATCTTGAATAGGGGCTGGG + Intronic
971005811 4:22373565-22373587 CTCCATCTTAAAGAGGAGCTGGG + Intronic
971006674 4:22382213-22382235 CTCCAACTTAAATAGGAGATGGG + Intronic
971016403 4:22493719-22493741 GTCCATCTTGAATAGGAGCTAGG + Intronic
971215786 4:24661229-24661251 CTCCATCTTGAATAGGAGCTGGG - Intergenic
971336181 4:25726058-25726080 CTCCATCTTGAATAGGGGCAAGG - Intergenic
971452365 4:26812012-26812034 CTCTATCTTGAATAGGAGCTGGG - Intergenic
971477655 4:27087524-27087546 CTCCATCTTGAATAGGGGCTAGG - Intergenic
971850085 4:31974415-31974437 CTCCATTTTGAATAGGGGCTAGG + Intergenic
971978645 4:33724900-33724922 CTCTATCTTGAATAGGGGCTGGG + Intergenic
972297306 4:37752510-37752532 CTCTATCTTGAATAGCAGCTGGG + Intergenic
972359936 4:38317469-38317491 CTCCATCTTGAATAGGGGCTGGG + Intergenic
972723096 4:41720558-41720580 CTCCATCTTGAATAGGAACTGGG + Intergenic
972921369 4:43946417-43946439 CTCCATCTTGAATAGGAGCTGGG - Intergenic
973336010 4:48957315-48957337 CTCTGTCTTAAATAGGAGCTGGG + Intergenic
973795260 4:54418612-54418634 CTCCATCTTGAATAAGAGCTGGG - Intergenic
973942800 4:55927316-55927338 CTCCATCTTAAATAGGAACTGGG + Intergenic
974022105 4:56700887-56700909 CTCCATCTTTAATAGGGGCTGGG + Intergenic
974051764 4:56948189-56948211 TTCCATCTTAAATAGGAGCTGGG - Intergenic
974052160 4:56951342-56951364 CTTCATCTTAAATAGGAGCTGGG - Intergenic
974179464 4:58364869-58364891 CTCCATCTTGAATAGGGACTGGG - Intergenic
974354001 4:60788940-60788962 CTCCATCTTGACTAGGGGCTTGG + Intergenic
974609677 4:64200155-64200177 CTCCATTTTGAATAAGAGCTGGG + Intergenic
974878135 4:67722242-67722264 CTCCATCTTGAATGGGGGCTGGG - Intergenic
975043001 4:69768461-69768483 CTCCATCTTAAATAGGAGCTAGG + Intronic
975043511 4:69773545-69773567 CTCCAGCTTAAATAAGAGCTAGG + Intronic
975059591 4:69980781-69980803 CTCCATCTTGAACAGGAGCTGGG + Intergenic
975415086 4:74096676-74096698 CTCCATCTTGAATAGGGGCTAGG - Intergenic
975528323 4:75375244-75375266 TTCCATCTTAAATAGGAGCTGGG + Intergenic
976004838 4:80417423-80417445 CTCCATCTTGAATAGGGGCTGGG - Intronic
976301809 4:83522441-83522463 CTCCATCTTGAATAGGGGCTAGG + Intronic
976468435 4:85398530-85398552 GAACATCTTAAATAGGACCCTGG - Intergenic
976515478 4:85959459-85959481 CTCCATCTAGAATAGGGGCTGGG - Intronic
976638336 4:87310833-87310855 CTCCATCTTGAATAGGGTCTGGG + Intronic
976643177 4:87361042-87361064 CTCCATCTTAAATAGGAGCTGGG + Intronic
976644013 4:87368568-87368590 CTCCATCTTGAATAGGAGCTGGG + Intronic
976697425 4:87932787-87932809 CTCCATCTTGAATAGGGGGTGGG + Intergenic
976747184 4:88414914-88414936 CTCCATCTTGAATAGGAGCTGGG - Intronic
976767283 4:88610524-88610546 CTCCATCTTAAACAAGAGCTGGG - Intronic
977100989 4:92814821-92814843 CACCATGTTCTATAGGAGCCAGG + Intronic
977205823 4:94164102-94164124 CTCCATCTTGAATAGGGGCTTGG + Intergenic
977480572 4:97569494-97569516 TTCCATCTTGAATAGGGGCTGGG - Intronic
977592775 4:98844899-98844921 CTCCATCTTGAATAGGGGCCGGG - Intergenic
977615534 4:99084151-99084173 CTCCACCTTGAATAGGCGCTGGG + Intronic
977673883 4:99726631-99726653 CTCCATCTTAAATAGGAGCTGGG - Intergenic
977674788 4:99734877-99734899 CTCCATCTTAAATAGGAGCTGGG - Intergenic
977758806 4:100705681-100705703 CTCCATCTTGAATAGGGGCTGGG - Intronic
977829301 4:101571461-101571483 CTCTATCTTAAACAGGAGCTGGG - Intronic
978223472 4:106305615-106305637 CTCCATCTTGAATAGGGGCTGGG + Intronic
978520404 4:109609625-109609647 CTCCATCTTAAATAGGGACTGGG - Intronic
978942588 4:114454531-114454553 CTTCATCTTAAATAGGAGCTGGG - Intergenic
978970023 4:114792343-114792365 CTTCATCTTGAATAGGAGCTCGG - Intergenic
979067501 4:116156860-116156882 CTCCATCTTGAATAAGAGCTGGG - Intergenic
979084014 4:116382848-116382870 CTCCATCTTAAATAGAACCTGGG + Intergenic
979362002 4:119775759-119775781 CTCCATTTTGAATAGGGGCTGGG - Intergenic
979773405 4:124558208-124558230 CTTTATCTTAAATAGGAGCTGGG + Intergenic
979773842 4:124562822-124562844 CTCCATCTTTAATAGGAGCTGGG + Intergenic
979811379 4:125040617-125040639 TTCCATCTTAAACAGAAGCTGGG + Intergenic
980014237 4:127630357-127630379 CTCCATCTTGAATAGGGGCTGGG - Intronic
980239779 4:130158917-130158939 CTCCATCTTAAATAGGGACTGGG + Intergenic
980717165 4:136640894-136640916 CTCCATCTTGAATAGGAGCTGGG - Intergenic
980777724 4:137458465-137458487 CTCCATCTTGAATAGGGGCTGGG - Intergenic
980987716 4:139711758-139711780 CTCCATCTTAAATAGGAACTGGG - Intronic
980988198 4:139715932-139715954 CTCCATGTTAAATAGGAGCTGGG - Intronic
981362886 4:143867260-143867282 CTCCATCTTGGATAGGGGCCTGG - Intergenic
981373615 4:143988060-143988082 CTCCATCTTGGATAGGGGCCTGG - Intergenic
981382716 4:144091331-144091353 CTCCATCTTGGATAGGGGCCGGG - Intergenic
981464813 4:145056067-145056089 CTCCATCTTGAATACGAGCTGGG + Intronic
981623726 4:146733693-146733715 CAACATCTTAAATAAGAGCTTGG + Intronic
981710988 4:147708862-147708884 CTCCATCTTGAATAGGGGCTGGG + Intergenic
982003054 4:151038638-151038660 CTCCATCTTGAATAGGGGCTGGG + Intergenic
982055868 4:151548346-151548368 CTCCATTTTGAATAGGGGCTGGG + Intronic
982236235 4:153253540-153253562 CTCCATCTTGAATAGGAGTCAGG + Intronic
982265851 4:153537790-153537812 CTCCATCTTAAATAGGAGCTGGG - Intronic
982345660 4:154355070-154355092 CTCCATCTTGAATAGGGGCTGGG + Intronic
982409596 4:155059436-155059458 GTCCATCTTGAATAGGGGCTGGG - Intergenic
982515901 4:156348619-156348641 CTCCATCTTGAATAGGGGCTGGG - Intergenic
982748405 4:159130335-159130357 CTCCATCTTAAATAGGGGCTGGG - Intronic
982864513 4:160493267-160493289 CTCCATCTTGAATAGGGCCTGGG + Intergenic
983401173 4:167268207-167268229 CTCCATCTTTAATAGGGGCTGGG + Intergenic
983732956 4:171020747-171020769 CATCATCTTGAATAGGAGCTGGG + Intergenic
983803239 4:171962255-171962277 CTCCATCTTGAATAAGGGCTGGG + Intronic
983862159 4:172720506-172720528 CTCCATCTTGAATAGGAGCTGGG - Intronic
983878089 4:172900095-172900117 CTCCATCTTGAATAGAGGCTGGG - Intronic
983995443 4:174176163-174176185 CTCCATCTTGAATAGGGGTAGGG - Intergenic
984118021 4:175706696-175706718 CTCCATCTTGAATAGGGGCTGGG + Intronic
984390462 4:179124570-179124592 CTCCATCTTGAATAGGGGCTGGG - Intergenic
984441203 4:179773413-179773435 CTCCATCTTGAATAGGAGCTGGG + Intergenic
984601195 4:181728808-181728830 CTCCATCTTGAAAAGGGGCTGGG - Intergenic
984650118 4:182262302-182262324 CACCGTCTTGAATAGGAGCTGGG + Intronic
984650768 4:182268499-182268521 CCCTATCTTAAATAGGAGCTGGG + Intronic
984706638 4:182851926-182851948 CTCCATCTTGAATAGGGGCTGGG + Intergenic
985101036 4:186458862-186458884 CTCCATCTTGAACAGGAGCTGGG - Intronic
985155577 4:186983992-186984014 CTCCATCTTGAATAGGGGCTGGG + Intergenic
985656083 5:1131943-1131965 CTCCATCTTGAACAGGGGCTGGG + Intergenic
985820466 5:2156577-2156599 CTCCATCTTGAATAGGGGCTGGG + Intergenic
986288833 5:6381410-6381432 CTCCATCTTGAATAGGAGCTGGG - Intergenic
986629494 5:9756046-9756068 CTCCATTTTAAATTGGGGCTGGG - Intergenic
986968682 5:13305867-13305889 CTCCATCTTGAACAGGAGTTGGG - Intergenic
987165849 5:15197077-15197099 CTCCATCTTAAATAGGAGCTGGG - Intergenic
987195374 5:15520317-15520339 CTCCATCTTGAATAGCAGCTGGG - Intronic
987318508 5:16746415-16746437 CTCCATCTTGAATAGGAGCTGGG - Intronic
987373287 5:17212640-17212662 CTCCATCTTGAATAGGGGCTGGG - Intronic
987499378 5:18687586-18687608 CTCCATCTTGAATAGGGGCTGGG - Intergenic
987761299 5:22165616-22165638 CTCCATCTTGAGTAGGGGCTGGG + Intronic
987848134 5:23314949-23314971 CCCCATCTTGAATAGGGGCTGGG + Intergenic
988087214 5:26487479-26487501 CCCCATCTTGAATGGGGGCCAGG - Intergenic
988131369 5:27110775-27110797 CTCCATCTTGAATAGGAGCTGGG - Intronic
988182709 5:27817746-27817768 CTCCATCTTAAACAGGAACTGGG + Intergenic
988210148 5:28193237-28193259 CTCTATCTTAAATAGGAGTTGGG - Intergenic
988388467 5:30597398-30597420 CTCCATCTTGAATAGGGGCTGGG + Intergenic
988569248 5:32347948-32347970 CTCCATCTTGAATAGAAGCTGGG + Intergenic
988781144 5:34522822-34522844 CTCCATCTTGAAGAGGGGCTGGG - Intergenic
988831299 5:34989920-34989942 CTCCATCTTGAACAGGGGCTGGG + Intergenic
989339422 5:40356350-40356372 CTCCATCTTGAATAGGGGCTGGG - Intergenic
989445846 5:41527372-41527394 TTCCATCTTAAATAGGGGCTGGG + Intergenic
989741955 5:44784107-44784129 CTCCATCTTGAATAGGGGCTGGG - Intergenic
990340914 5:54822141-54822163 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
990636626 5:57735353-57735375 CTCCATCTTGAATAGGAGCTGGG + Intergenic
991432569 5:66563500-66563522 CTCCATCTTAAATAGGAGCTGGG + Intergenic
991527951 5:67583530-67583552 CTCCATCTAAAAAAAAAGCCAGG - Intergenic
991628342 5:68628270-68628292 CTCCATTTTGAATAGAAGCTGGG + Intergenic
991676077 5:69091177-69091199 CTCCATCTTGAATAGGAGCTGGG - Intergenic
991676189 5:69092004-69092026 CTCCATCTTGAATAGGGGCTGGG + Intergenic
991896090 5:71399080-71399102 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
991948800 5:71927718-71927740 CTCCATCTTGAACAGGGGCTTGG + Intergenic
992159774 5:73989946-73989968 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
992245311 5:74815593-74815615 CTCCATCTTAAATAGGAACTGGG + Intronic
992371297 5:76146691-76146713 CTCGGTCTTGAATAGGAGCTGGG - Intronic
992392227 5:76339850-76339872 CTCCATCTTGAATAGGGGCTGGG + Intronic
992438867 5:76780852-76780874 CTCCATCTTCAGTAGGGGCTGGG + Intergenic
992440469 5:76793568-76793590 CTCCATCTTGAATAGGGGCTGGG - Intergenic
992542478 5:77778590-77778612 CTCCATCTTGAATAGGGTCTGGG + Intronic
992796661 5:80259688-80259710 CTCCATCTTGAATAGGGACTGGG + Intergenic
992865846 5:80956492-80956514 CTCCATCTTAAATAGGAGCCGGG - Intergenic
993130987 5:83898078-83898100 CTCCATCTTAAATAGGGGCTGGG + Intergenic
993328987 5:86573020-86573042 CTCCATCTTAAATAGGAGCTGGG + Intergenic
993717738 5:91292148-91292170 CTCCATCTTGAATAGGGGCTGGG - Intergenic
993780438 5:92060371-92060393 CTCCATCTTAAATATTCGCTGGG + Intergenic
993829900 5:92742147-92742169 CTCCATCTTGAATAGGAGCTGGG - Intergenic
993939205 5:94039217-94039239 CTCCATCTTGAATAGGAGGTGGG + Intronic
993939759 5:94044603-94044625 CTCCGTCTTGAAAAGGAGCTGGG + Intronic
993980507 5:94538945-94538967 CTCCGTCTTGAATAGGAGCTGGG + Intronic
994088995 5:95791957-95791979 CTGCATCTTGAATAGGGGCTGGG - Intronic
994185370 5:96809319-96809341 CTCCATCTTGAATAGGAGCTGGG - Intergenic
994520053 5:100822696-100822718 CTCCATCTTGAATAGGCGCTGGG + Intronic
994532056 5:100984081-100984103 CTCCATCTTGAATAGGAGCTGGG - Intergenic
994777946 5:104059270-104059292 TGCCATCTTAAATAGGAGCTGGG - Intergenic
994959934 5:106586753-106586775 CTCTGTCTTAAATAGGAGCTGGG + Intergenic
995110347 5:108421902-108421924 CTCCATCTTGAATCGGGGCTGGG - Intergenic
995261164 5:110106109-110106131 CTCCAACTTGGATAGGAGCTGGG + Intergenic
995523537 5:113032644-113032666 CTCCATCTTAAATAGGAGTTAGG + Intronic
995794905 5:115930798-115930820 CTCCATCTTAAACAGGAGCTGGG - Intergenic
996057254 5:118995057-118995079 TTCCATCTTGAATAGGAGCTGGG - Intergenic
996143895 5:119949604-119949626 CTCCATCTTAAATAGGGGCTGGG + Intergenic
996149369 5:120016665-120016687 CTCCATCTTAAGAGGGGGCCAGG + Intergenic
996293298 5:121880019-121880041 CTCCATCTTGAATAGGAGCTGGG - Intergenic
996351092 5:122542678-122542700 CTCCATCTTGAATAGGAGCTGGG + Intergenic
996532715 5:124543393-124543415 ATCCATCCTAAATGGAAGCCTGG + Intergenic
996707802 5:126514549-126514571 CTCCACCTTGAATAGGGGCTGGG - Intergenic
996925717 5:128823959-128823981 CTCCATCTTAAATAGGAGCTGGG + Intronic
997113602 5:131102021-131102043 CTCCATCTTGAATAGGGGCTGGG + Intergenic
997172782 5:131740695-131740717 CTCCATCTTGAATAGGGGCTGGG + Intronic
997341282 5:133146979-133147001 CTTCATCTTGAATAGGAGCTGGG + Intergenic
997436083 5:133876659-133876681 CTCCGTCTTGAATAGGGGCTGGG + Intergenic
998419822 5:141973633-141973655 CTCCATCGTAAATACTTGCCAGG - Exonic
998942468 5:147299479-147299501 CTCCATCTTAAATAGGAGCTGGG - Intronic
998982930 5:147724883-147724905 CTCCATCTTGAATAGGAGCTGGG + Intronic
999584888 5:153079495-153079517 CTCCACCTTGAATAGGGGCTGGG + Intergenic
999620095 5:153464089-153464111 CTGCATCTTGAATAGGGGCTGGG - Intergenic
999965449 5:156804626-156804648 CTCCATCTTAGATAGGGGCTGGG - Intergenic
1000060913 5:157654564-157654586 CTCCATCTTGAGTAGGTGCTGGG + Intronic
1000065925 5:157693422-157693444 CTCCATCTTGAGTAGGTGCTGGG + Intergenic
1000090554 5:157926253-157926275 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1000128200 5:158268327-158268349 CTCGATTTTAGATACGAGCCTGG + Intergenic
1000284128 5:159811914-159811936 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1000311027 5:160044819-160044841 CTCCATCTTGAATAGGGGCTGGG - Intronic
1000370993 5:160536477-160536499 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1000415495 5:160979979-160980001 TTCCATCTTAAACAGGAGCTGGG + Intergenic
1000415916 5:160983703-160983725 CTTCATCTTAAATAGGAGCTGGG + Intergenic
1000600960 5:163273984-163274006 GTCCATCTTGAATAGGGGCTGGG - Intergenic
1001358314 5:171054728-171054750 TTCCATCTTGAATAGGGGCTGGG - Intronic
1001388732 5:171361314-171361336 CTCCATCTTGAATGGGGGCTGGG + Intergenic
1001972661 5:175968792-175968814 CTCTATCTTAAATAGGAACTGGG + Intronic
1002244777 5:177874990-177875012 CTCTATCTTAAATAGGAACTGGG - Intergenic
1003123823 6:3339452-3339474 CTCCATCTTAAACAGGAGCTGGG + Intronic
1003372496 6:5542243-5542265 CTCCATCTTGAGTAGGAGCTGGG - Intronic
1003776243 6:9368776-9368798 CTCCATCTTGAATAGGGACTGGG - Intergenic
1003787609 6:9504708-9504730 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1003897100 6:10617633-10617655 CTCCATCTTAAATAGGAGCTGGG - Intronic
1003901903 6:10662329-10662351 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1004098786 6:12586837-12586859 CTCCATCTCGAATAGGAGCTGGG + Intergenic
1004389468 6:15197981-15198003 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1004390683 6:15207140-15207162 CTCCATCTTGAGTAGGGGCTAGG + Intergenic
1004391086 6:15210343-15210365 CTCCATTTTGAATAGGGGCTGGG + Intergenic
1004432842 6:15561679-15561701 CTCCATCTTGAATAGGGGCTGGG + Intronic
1004467112 6:15896225-15896247 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1004467267 6:15897702-15897724 CTTCATCTTGAATAGGGGCTAGG + Intergenic
1004608993 6:17220814-17220836 CTCCATCTTGAATGGGGGCTGGG - Intergenic
1004850052 6:19690187-19690209 CTCCATCTTGAATAGGGGTTGGG + Intergenic
1004909912 6:20272972-20272994 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1005019199 6:21401581-21401603 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1005331687 6:24756770-24756792 CTCCATCTTGAATAGGGCCTGGG - Intergenic
1005448596 6:25951765-25951787 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1005449036 6:25955241-25955263 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1005570069 6:27136388-27136410 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1005776936 6:29144024-29144046 CTCCATCTTGAATAGCAGCTGGG + Intergenic
1005983421 6:30854883-30854905 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1005985774 6:30873902-30873924 TCCCATCTTAAATAAGAGCTGGG + Intergenic
1006213414 6:32416616-32416638 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1007305242 6:40898826-40898848 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1007353508 6:41292874-41292896 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1008291168 6:49717566-49717588 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1008590470 6:52988896-52988918 CTCCATCTTGAACAGGAGCTGGG + Intronic
1008911570 6:56739521-56739543 CTCCATCTTGAATAGGAGCTAGG + Intronic
1008928081 6:56908601-56908623 CTCCACCTTAAACAGGAGCTAGG + Intronic
1009197796 6:60708194-60708216 CTCCATCCTAAATCTGAGCAAGG - Intergenic
1009413470 6:63392657-63392679 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1009604395 6:65848427-65848449 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1009681673 6:66901143-66901165 CTCCATCTTGAATAGGGACTGGG - Intergenic
1010234580 6:73564684-73564706 CTCCATCTTGAATAGTGGCTAGG + Intergenic
1010433794 6:75807930-75807952 CTCCATCTTGAATAGGAGGTGGG - Intronic
1010445986 6:75949158-75949180 CTCCATCTTGAATAGGAGCTGGG + Intronic
1010486574 6:76421582-76421604 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1010542591 6:77110078-77110100 CTCCATGTTGAATAGGGGCTGGG - Intergenic
1010583942 6:77634634-77634656 CTCCATATTGAATAGGGGCTGGG + Intergenic
1010718552 6:79257653-79257675 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1010970106 6:82253889-82253911 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1011528685 6:88295831-88295853 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1011595151 6:89008927-89008949 CTCCATCTTGAGTAGGTGCTGGG - Intergenic
1011809492 6:91114057-91114079 CTCCATCTTGATTAGGGGCTGGG + Intergenic
1011965717 6:93155414-93155436 CTCCATCTTGAGTAGGAACTGGG - Intergenic
1012059948 6:94465582-94465604 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1012211140 6:96520505-96520527 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1013047655 6:106503241-106503263 TTCCATCATAACTGGGAGCCTGG + Intergenic
1013179051 6:107702808-107702830 CTCCATCTTGAATGGGAGCTGGG + Intergenic
1013211158 6:107988052-107988074 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1013247563 6:108301325-108301347 CTCCATTTTAAATAAGGGCTGGG - Intronic
1013364361 6:109424550-109424572 CTTCATCTTGAATAGGAGCTGGG + Intronic
1013375710 6:109512009-109512031 CTCCATCTTGAGTAGGGGCTGGG + Intronic
1013473683 6:110488074-110488096 CTCCATTTTGAATAGGAGCTGGG + Intergenic
1013523471 6:110953851-110953873 CTCCATCTTTAATAGGGGCTGGG + Intergenic
1013657086 6:112257122-112257144 TTCCATCTTGAATAGGGGCTGGG + Intergenic
1013887994 6:114994383-114994405 CTCCATCTTGAATAGGGACTGGG + Intergenic
1013921953 6:115416312-115416334 CTCCATCTTAAATATGAGCTGGG + Intergenic
1014022399 6:116606101-116606123 CTCCATCTTGAATAGCGGCTGGG - Intergenic
1014200313 6:118601998-118602020 CTCCATCTTAAACAGGAGCTGGG - Intronic
1014621255 6:123669457-123669479 TTCCATCTTGAATAGAGGCCAGG - Intergenic
1014670118 6:124292610-124292632 ATCCATCTTGAACAGGAGCTGGG - Intronic
1014944562 6:127481758-127481780 CTACATCTTGAATAGGAGCTGGG + Intronic
1015159119 6:130132000-130132022 CTCCATCTTGAGCAGGAGCTGGG - Intronic
1015223462 6:130830579-130830601 CTCCATCTTGAATAGGGGCTAGG + Intronic
1015270389 6:131332306-131332328 CTCCATCTTGAATAGCGGCTGGG + Intergenic
1015288283 6:131509297-131509319 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1015333019 6:132003527-132003549 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1015569990 6:134610999-134611021 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1015696985 6:135991274-135991296 CTCCATCTTGAGTAGGGGCTGGG - Intronic
1016006283 6:139092276-139092298 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1016012904 6:139157389-139157411 CTCTATCTTAAATAGGAGCTGGG - Intronic
1016108766 6:140194982-140195004 CTCCATCTTGAATATGGGCTGGG + Intergenic
1016207835 6:141491176-141491198 CTCCATCTTAAATAGGATCTGGG + Intergenic
1016406892 6:143740416-143740438 CTCCATCTTGAATAGAGGCTGGG - Intronic
1016513944 6:144873016-144873038 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1016686447 6:146887646-146887668 CTCCATTTTGAATAGGGGCTGGG - Intergenic
1016699175 6:147034492-147034514 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1016733379 6:147449768-147449790 CTCCATCTTGAATGGGGGCTGGG - Intergenic
1017145264 6:151229125-151229147 CTCCAATTTGAATAGGAGCTGGG + Intergenic
1017177683 6:151520062-151520084 CTCCATCTTGAATAGGGGCTGGG - Intronic
1017256043 6:152334846-152334868 CTCCATCTTGAATAGGGGCTGGG - Intronic
1017348851 6:153415940-153415962 CTCCATCTTGAATAAGGGCTTGG - Intergenic
1017406395 6:154124008-154124030 CTCCATCTTGAATAGAGGCTGGG - Intronic
1017464196 6:154679330-154679352 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1017780182 6:157709756-157709778 CTCCGTCTTGAGTAGGAGCTAGG + Intronic
1017814053 6:158004175-158004197 CTCCATCTTGAATAGGGGCTGGG + Intronic
1017900058 6:158712030-158712052 CTCCATCTTGAATAGGAGCTGGG - Intronic
1018357771 6:163035891-163035913 CTCCATCTTGAATAGGAGCTGGG - Intronic
1018363899 6:163099106-163099128 ATCCATCTTAAATAGAAGCTGGG - Intronic
1018435820 6:163758078-163758100 CTCCGTCTTGAATAGGGGCTGGG + Intergenic
1018478126 6:164163137-164163159 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1018494759 6:164337839-164337861 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1018535805 6:164818064-164818086 CTCTGTCTTAGAGAGGAGCCAGG + Intergenic
1018681576 6:166270035-166270057 CTCCATCTTGAGTAGGGGCTTGG - Intergenic
1018759411 6:166878202-166878224 CTCCATCTTGAAGAGGGGCTGGG - Intronic
1018792774 6:167162229-167162251 CTCCATCTTGAATAGGGGCTGGG - Intronic
1019007302 6:168809738-168809760 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1019545431 7:1572323-1572345 CTTCATCTTGAATAGGGGCTGGG - Intergenic
1019586099 7:1804533-1804555 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1019791395 7:3016194-3016216 TTCCATCTTGAATAGGAGCTGGG + Intronic
1019810194 7:3159500-3159522 CTCTATCTTGAAGAGGAGCTGGG - Intronic
1019822986 7:3259858-3259880 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1019823337 7:3262702-3262724 CTCCATCTTGAAGAGGAACTGGG + Intergenic
1019946511 7:4333823-4333845 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1020355039 7:7266454-7266476 CTCCATCTTGCATAGGGGCTAGG + Intergenic
1020802437 7:12748287-12748309 CTCTATCCTGAATAGGAGCTGGG - Intergenic
1020804612 7:12773018-12773040 TTCCATCTTGAACAGGAGCTGGG - Intergenic
1020942269 7:14555585-14555607 CTCCATCTAGAATAGGAGTAAGG + Intronic
1021386734 7:20039825-20039847 CCCCATCCTGAATAGGAGCTGGG - Intergenic
1021550476 7:21866140-21866162 CTCCATCTTGAATAGGAGCTGGG - Intronic
1021583269 7:22179522-22179544 CTCCATCTTGAATAGGGGCTGGG + Intronic
1021860336 7:24899807-24899829 CTGCATCTTAAATAAGAATCCGG - Intronic
1022111107 7:27232340-27232362 CTCCAACTTTATTAGGAACCTGG + Intergenic
1022272714 7:28825987-28826009 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1022356502 7:29620018-29620040 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1022478604 7:30728164-30728186 CTCCATCTTGAATAGGAGCTCGG + Intronic
1023046857 7:36217592-36217614 CTCCATCTTGAATAGGGGCTGGG - Intronic
1023049478 7:36238381-36238403 TTCCATCTTGAATAGGGGCTGGG - Intronic
1023053839 7:36276076-36276098 CTCCATCTTGAATAGGGGCTGGG + Intronic
1023197795 7:37660867-37660889 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1023514936 7:40992517-40992539 CTCCATCTTGAATAGGGACTCGG - Intergenic
1023588024 7:41751183-41751205 CTCCATCTTGAATGGGGGCTGGG - Intergenic
1023932910 7:44717398-44717420 CTGCATCTTGAATAGGGGCTGGG - Intergenic
1023933696 7:44723950-44723972 CTCCATCTTGAATAGGGGGCTGG - Intergenic
1024013522 7:45291111-45291133 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1024039913 7:45544672-45544694 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1024081381 7:45858867-45858889 CTCCATTTTAAATAGGAGCTGGG - Intergenic
1024322722 7:48086771-48086793 CTTCATCTTGAATAGGAGCTGGG + Intergenic
1024484761 7:49905669-49905691 CTCCATCTTGAATAGGGGCTGGG + Intronic
1024601428 7:50985011-50985033 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1024621076 7:51158463-51158485 CTGCATCTTAAATATGTCCCAGG - Intronic
1024629927 7:51238559-51238581 CTCCATCTTGAATAGGGGATGGG + Intronic
1024641201 7:51330008-51330030 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1024705859 7:51959171-51959193 CTCCATCTTCAATAGGGACTGGG - Intergenic
1024825517 7:53385784-53385806 CTCCATCTTAAATAGAGGCTGGG + Intergenic
1024832059 7:53472520-53472542 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1025111187 7:56217687-56217709 CTCCATCTTGAGTAGGAGCTGGG + Intergenic
1025186627 7:56865421-56865443 CTCGATCTTAAGTAGGAGCTGGG + Intergenic
1025241661 7:57281753-57281775 CTGCGTCTTAAATAGGAGCTGGG + Intergenic
1025685295 7:63711491-63711513 CTCGATCTTAAGTAGGAGCTGGG - Intergenic
1025768495 7:64481715-64481737 CTTCATCTTTAATAGGAGCTGGG + Intergenic
1025769182 7:64488252-64488274 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1025835862 7:65092963-65092985 CTCGATCTTAAATAGAAGCTGGG - Intergenic
1025849409 7:65233705-65233727 CTCCATCTTAAATAGCAGCTGGG + Intergenic
1025905638 7:65782416-65782438 CTTGATCTTAAATAGAAGCTGGG - Intergenic
1026097747 7:67360079-67360101 CTCCATTTTGAATAGGGGCTGGG + Intergenic
1026118540 7:67516837-67516859 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1026119749 7:67526382-67526404 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1026124680 7:67569171-67569193 CTTCATCTTGAATAGGAGTTGGG - Intergenic
1026139361 7:67692181-67692203 CTCCATCCTGAATAGAAGCTAGG - Intergenic
1026143628 7:67727002-67727024 CTCCATCTTGAATAGGGGTTGGG - Intergenic
1026166449 7:67914298-67914320 CTTCATCTTGAATAGGAGCTGGG + Intergenic
1026235744 7:68525587-68525609 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1026253720 7:68692669-68692691 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1026288344 7:68983772-68983794 CTCCATCTTGAATAGAAGCTGGG + Intergenic
1026301886 7:69105215-69105237 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1026302132 7:69107190-69107212 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1026306715 7:69148783-69148805 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1026490578 7:70859753-70859775 CTCCATCTTGAATAAGAGCTGGG - Intergenic
1026493740 7:70885132-70885154 CTCCATCTTGAATAGGGGCCGGG + Intergenic
1026519787 7:71106725-71106747 CTCCATCTTGAATAGGGGTTGGG - Intergenic
1026561968 7:71457877-71457899 CTCCATCTTGAAAAGGAGCTGGG - Intronic
1026562369 7:71461038-71461060 CTCCATCTTGAATAAGGGCTTGG - Intronic
1026562752 7:71464011-71464033 CTCCATCTTGAATAGGGGCTGGG - Intronic
1026563977 7:71474408-71474430 CTCCATCTTGAATAGGGGCTGGG - Intronic
1026583363 7:71636057-71636079 CTCCATCTTGAATAGGGGCTGGG - Intronic
1026583663 7:71638386-71638408 CTCCATCTTGAATAGGGGATGGG - Intronic
1026611000 7:71859808-71859830 CTCCATCTTGAATAGGGGCTGGG + Intronic
1026631052 7:72038537-72038559 CTCCATCTTGAATAGGAGCTGGG + Intronic
1026737893 7:72960451-72960473 CTCCATTTGAAATGGGAGCTGGG - Intronic
1026861232 7:73791228-73791250 CTCCATCTTTAACAGGAGCAGGG + Intergenic
1026917953 7:74133790-74133812 CTCTATCTTGAATAGGGGCTGGG + Intergenic
1026921651 7:74160065-74160087 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1027105841 7:75404617-75404639 CTCCATTTGAAATGGGAGCTGGG + Intronic
1027160972 7:75801888-75801910 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1027161741 7:75807677-75807699 CTCCATCTTAAATATGGGCTAGG + Intergenic
1027365050 7:77448489-77448511 CTCCATCTTGAGTAGGAACTGGG - Intergenic
1027616440 7:80430335-80430357 CTCCATCTTGAATAGGAGCTGGG - Intronic
1027796233 7:82696872-82696894 CTCCATCTTGAATAGGGGATGGG - Intergenic
1027796452 7:82699994-82700016 CTCAATCTTGAATAGGAGCTGGG + Intergenic
1027856111 7:83513882-83513904 CTCCATCTTGAATAGGAGCTAGG + Intronic
1027958432 7:84913089-84913111 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1028388829 7:90291546-90291568 CTCCATCTTGAATAGGGCCTGGG - Intronic
1028389300 7:90296110-90296132 CTCCATCTTGAATAGGGGCTGGG - Intronic
1028486561 7:91365093-91365115 CTTTATCTTAAATAGGAGCTGGG + Intergenic
1029119199 7:98255140-98255162 CTCCATCTTGAACAGGGGCTGGG + Intronic
1029164877 7:98580864-98580886 CTCCATCTTGAATAGGAACTGGG - Intergenic
1029222244 7:98999863-98999885 CTCCATCTTAAATACTCGCCAGG + Intronic
1029499584 7:100920208-100920230 CTCCATCTTGAATAGGAACTGGG - Intergenic
1029588575 7:101491891-101491913 GTCCATCTTAAATAGGAGCTAGG - Intronic
1030100057 7:105937847-105937869 CTCCATCTTGAATAGGGACTGGG + Intronic
1030123121 7:106130048-106130070 CTCCATCTTCAATAGGAGCTGGG + Intergenic
1030189586 7:106796899-106796921 CTCCATCTTGAATAGAAGCTGGG - Intergenic
1030190091 7:106801768-106801790 CTCCGTCTTGAATAGGAGCTGGG - Intergenic
1030224143 7:107130052-107130074 CTCCATCTTGAATAGGAGCTGGG - Intronic
1030316324 7:108118059-108118081 CTCCATCTTGAATAGGAGCTGGG - Intronic
1030601488 7:111597773-111597795 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1030610122 7:111680135-111680157 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1031173504 7:118320383-118320405 CTCCATCTTCAATAGGTGCTGGG - Intergenic
1031416672 7:121503951-121503973 CTCCATCTTTAATAGGGGCTGGG + Intergenic
1031533738 7:122908507-122908529 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1031582958 7:123499779-123499801 CTCCATCTTGAATAGGAGCTGGG + Intronic
1031704747 7:124965737-124965759 CTCCATCTTGAATAGGGGCTAGG - Intergenic
1031746494 7:125505556-125505578 CTTTATCTTAAATAGGAGCTGGG - Intergenic
1031775850 7:125908561-125908583 CTTCATCTTGAATAGGGGCTGGG + Intergenic
1032056980 7:128691455-128691477 CTCCATCTTGAATGGGGGCTGGG + Intergenic
1032068399 7:128789866-128789888 CTCCATCTTGAATAGAAGCTGGG + Intergenic
1032088343 7:128895544-128895566 CTCCATCTTGAATAGGGGCTAGG + Intronic
1032123082 7:129170786-129170808 CTCCATCTTCAATAGGCGCTGGG - Intergenic
1032136145 7:129280048-129280070 CTCCATCTTAAATAGAGGCTGGG - Intronic
1032461574 7:132115269-132115291 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1032521455 7:132548692-132548714 CTCCATCTTGAATAGGGGATGGG + Intronic
1032707031 7:134430052-134430074 ATCCAGCTTAAATAGGTGCCTGG + Intergenic
1032796904 7:135284975-135284997 CTCCTCCTTTAATAGGAGCAAGG + Intergenic
1032864177 7:135909450-135909472 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1032961506 7:137040843-137040865 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1032986807 7:137346230-137346252 CTCCATCTTGAATAGGTGCTGGG - Intergenic
1033030208 7:137819119-137819141 CTCCAGCTTAACTGGGAACCTGG + Intronic
1033119874 7:138658233-138658255 CTCCATCTTTAATAGGGGCTGGG - Intronic
1033161510 7:139001214-139001236 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1033161954 7:139005770-139005792 TTCCATCTTGAATAGAAGCTGGG + Intergenic
1033162090 7:139006687-139006709 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1033162524 7:139010226-139010248 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1033465885 7:141589104-141589126 CTCCATCTTGAGTAGGGGCTGGG - Intronic
1033577894 7:142703823-142703845 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1033655418 7:143370387-143370409 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1033662571 7:143412516-143412538 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
1033837217 7:145329924-145329946 CTCTATCTTGAATAGGGGCTGGG - Intergenic
1034016814 7:147596687-147596709 CTCCATCTTGAATAAGAGCTGGG + Intronic
1034093770 7:148387822-148387844 CTCCATCTCGAATAGGGGCTGGG + Intronic
1034116256 7:148586397-148586419 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1034180467 7:149133516-149133538 CTTCATCTTGAATAGGGGCTGGG - Intronic
1034250602 7:149687551-149687573 CTCCATCTTGAATAAGGGCTGGG - Intergenic
1034335689 7:150322238-150322260 CTCCATCTTGAATAAGGGCTGGG + Intronic
1034788471 7:153946654-153946676 CTCCATCTTGAATAGGGGCTGGG - Intronic
1034915705 7:155037005-155037027 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1035127698 7:156620365-156620387 CTCCATCTTAAACAGGAGCTGGG - Intergenic
1035959739 8:4124373-4124395 CTCCATATCAAAAAGGAGACAGG + Intronic
1036101536 8:5792389-5792411 CTCCATCTTAATTAGGAGCAGGG + Intergenic
1036575980 8:10028044-10028066 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1036641016 8:10583849-10583871 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1037012015 8:13855488-13855510 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1037188802 8:16097519-16097541 CTCTATCTTGAATAGGGGCTGGG + Intergenic
1037304355 8:17489733-17489755 CCTCATCTTAAATAGGAGCTGGG - Intergenic
1037314194 8:17585341-17585363 CTCCATCTTGAATAGGGGCTGGG - Intronic
1037367650 8:18140034-18140056 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1037379868 8:18274070-18274092 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1037586071 8:20276968-20276990 CTCCATGTTGAATAGGGGCTGGG + Intronic
1037595742 8:20352794-20352816 CTCCATCTTAAGTAGGGGCTGGG - Intergenic
1037613930 8:20500190-20500212 CTCCATCTTAAATAAGGGCTGGG + Intergenic
1037614608 8:20507482-20507504 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1037649113 8:20820645-20820667 CTCCATCTTGAGTAGGGGCTCGG - Intergenic
1038125797 8:24671471-24671493 CTCCATCCTGAATAGGGGCTGGG + Intergenic
1038338846 8:26667254-26667276 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1038413555 8:27376474-27376496 CTCCATCTTAAACAGGAGCTAGG + Intronic
1038439634 8:27562383-27562405 CTCCATTTTGAACAGGAGCTGGG - Intergenic
1038548364 8:28443616-28443638 CTCCATCTTGAATAGGAGCTGGG + Intronic
1038645668 8:29359817-29359839 CTCCATCTTAACTCGGAGCTGGG + Intergenic
1038652199 8:29415154-29415176 CTCCATCTTGAATATGGGCTGGG + Intergenic
1038675281 8:29617266-29617288 CTCCATCTTGAATAGGGACTGGG + Intergenic
1038690672 8:29760227-29760249 ATTCATTTTAAATAGGAGGCAGG + Intergenic
1039067717 8:33623542-33623564 CTCCATCTTGAATAGGAGCTAGG - Intergenic
1039438109 8:37575147-37575169 CTCCATCTTGAATAGATGCTGGG + Intergenic
1039499470 8:38005231-38005253 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1039569654 8:38576575-38576597 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039579554 8:38652949-38652971 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039741672 8:40388605-40388627 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1039816378 8:41098237-41098259 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039819886 8:41126140-41126162 CTCCATCTTAAACAGGAGCTAGG - Intergenic
1039827549 8:41187849-41187871 CTCCATCTTGAATAGGGGCTTGG - Intergenic
1039882095 8:41631341-41631363 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039945213 8:42123052-42123074 CTCTATCTTGAATAGGAGCTGGG - Intergenic
1039963352 8:42266567-42266589 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1039970402 8:42317027-42317049 CTCCAACTTAAAAACCAGCCAGG - Intronic
1040417523 8:47208367-47208389 CTCCATCTTGAATACGGGCTGGG - Intergenic
1040620983 8:49092702-49092724 CTCTATGTTAAATGGGAACCAGG + Intergenic
1040854628 8:51936173-51936195 CTCCATCTTAAATACGAGCTGGG + Intergenic
1040997864 8:53419923-53419945 CCCCATCTTGAATAGGGGCTGGG + Intergenic
1041073831 8:54151063-54151085 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1041229252 8:55732195-55732217 CTCCATTTTGAATAGGGGACAGG - Intronic
1041716265 8:60935122-60935144 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1041742172 8:61167604-61167626 CTCCGTCTTGAATAGGACCTGGG + Intronic
1041773504 8:61498125-61498147 CTCCATCTTAAATAGGGGCTGGG - Intronic
1041774532 8:61509660-61509682 CTCCATCTTGAATAGGGGCTGGG - Intronic
1041918049 8:63155555-63155577 CTCCATCTTAAATAGGGGCTGGG - Intergenic
1041924701 8:63224550-63224572 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1042125753 8:65535749-65535771 CTCCATCTTGAATATGGGCTGGG + Intergenic
1042159071 8:65873853-65873875 CTCCATCTTAAATAGGGGCTGGG + Intergenic
1042309503 8:67366369-67366391 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1042344777 8:67716217-67716239 CTCCATCTTGAATAAGTGCTGGG + Intronic
1042455876 8:69002066-69002088 TTCCATCTTGAATAGGGGCTGGG + Intergenic
1042732859 8:71956216-71956238 CTCCATCTTGAATAGGAGCTGGG - Intronic
1042948341 8:74176610-74176632 CTCCATCTCGAATAGGAGCTGGG + Intergenic
1042984661 8:74569664-74569686 CTCCATCTTAAATAGGTGCTGGG - Intergenic
1043004137 8:74797002-74797024 CTCCATCTTGAATAGGGGCTGGG - Intronic
1043069317 8:75619188-75619210 TTCCATCTTAAATAGGAGCTGGG - Intergenic
1043070662 8:75631719-75631741 CTCCATCTTACATAGGAACTGGG - Intergenic
1043777814 8:84292450-84292472 CTCCCTCTTAAATAGGAGTGGGG + Intronic
1043839780 8:85089188-85089210 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1043870909 8:85431415-85431437 CTCCATCTTGAATAAGGGCTCGG + Intronic
1043936056 8:86143776-86143798 CTCCATCTTGAATAGGGGCTGGG - Intronic
1044439260 8:92204238-92204260 CTCCATCTTGAGTAGGAGCTGGG - Intergenic
1044441268 8:92227229-92227251 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1044984812 8:97748108-97748130 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1044986742 8:97762665-97762687 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1045253200 8:100498377-100498399 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1045282923 8:100765195-100765217 CTCCATCTTGAATGGGGGCTGGG + Intergenic
1045352608 8:101355983-101356005 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1045660976 8:104437286-104437308 CTCCATCTTGAAGAGGGGCTGGG + Intronic
1045688500 8:104736434-104736456 CTCCATCTTAAATAGGAGCTGGG + Intronic
1045691277 8:104762414-104762436 CTCCATCTTGAATAGGGGCTGGG - Intronic
1045691431 8:104763736-104763758 CTCCATCTTGAATAGGAGCTGGG - Intronic
1046184462 8:110694511-110694533 CTCCATCTTAAACAGGGACTTGG - Intergenic
1046270009 8:111883113-111883135 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1046494389 8:114994996-114995018 CTCTAACTTAAATAGGAGCTAGG - Intergenic
1046502369 8:115095460-115095482 CTCCATATTAAACAGGAGCTGGG + Intergenic
1046511528 8:115210509-115210531 CTCCATCTTGAATAAGAGCTGGG + Intergenic
1046526397 8:115386838-115386860 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1046675673 8:117105194-117105216 CTCCATCTTTAACAGGGGCTGGG - Intronic
1046751391 8:117930695-117930717 CTCCATCTTGAGTAGGGGCTGGG + Intronic
1046837680 8:118821133-118821155 CTCCATCTTGAATAGAAGCTGGG - Intergenic
1046920059 8:119718523-119718545 AACCATCTTGAATAGGAGCTGGG + Intergenic
1047003375 8:120595169-120595191 CTCCATCTTGAATAGGAGCTGGG + Intronic
1047112697 8:121808743-121808765 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1047354989 8:124111911-124111933 CTCCATCTTGAATAGGAGCTGGG - Intronic
1047390910 8:124450526-124450548 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1047526673 8:125639964-125639986 CTCCATTTTGAGTAGGAGCTGGG + Intergenic
1048324238 8:133426762-133426784 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1048324349 8:133427630-133427652 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1048439469 8:134449472-134449494 CTCCATCCTAAATAAGGGCTGGG - Intergenic
1048875229 8:138831867-138831889 CTCCATCTTAAACAGGAGCTGGG + Intronic
1049124481 8:140774558-140774580 CTCCATCTTGAATAGGGGCTCGG + Intronic
1049500135 8:142958493-142958515 CTCTATCTTAAATAGGAGCTGGG - Intergenic
1049500969 8:142965660-142965682 CTCCATCTTAAACAGGAACTGGG + Intergenic
1050030049 9:1376339-1376361 CTCCATCTTGAATAGGGGCTTGG - Intergenic
1050141916 9:2524970-2524992 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1050141921 9:2525005-2525027 CTCCATCTTGAATAGGGGCCAGG + Intergenic
1050739123 9:8800314-8800336 CTCCATCTTGAATAGGGGCTGGG + Intronic
1050741379 9:8824233-8824255 CTCCATCTTAAATAAAAGCTGGG - Intronic
1050932474 9:11347916-11347938 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1050959169 9:11705639-11705661 TTCCATCTTGAATAGGGGCTTGG + Intergenic
1051030388 9:12667550-12667572 CCCTATCTTGAATAGGAGCTGGG - Intergenic
1051225609 9:14895955-14895977 CTCCAACTTGAATAGGAGCTGGG + Intronic
1051363449 9:16302892-16302914 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1051467372 9:17395836-17395858 CTCCATCTTAAATAGGAGCTGGG + Intronic
1051467582 9:17397689-17397711 CTCCATCTTGAATAGGTGCTGGG - Intronic
1051582167 9:18688773-18688795 CTCCATCTCAAATAGGCACTGGG - Intronic
1051859592 9:21609337-21609359 GTCCATCTTCAATAGGGGCTGGG + Intergenic
1051903267 9:22065290-22065312 CTCCATCTCACAAATGAGCCAGG - Intergenic
1051974529 9:22933533-22933555 ATCCATCTTGAATAGGAGCTGGG - Intergenic
1052520839 9:29547120-29547142 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1052521528 9:29554073-29554095 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1052663394 9:31464729-31464751 CTCTATCTTAAATAGGAACTGGG - Intergenic
1052663932 9:31470317-31470339 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1052773414 9:32710065-32710087 CAGCATCTTGAAGAGGAGCCGGG + Intergenic
1052891379 9:33703643-33703665 CTCCATCTTAAGTAGGAGCTGGG + Intergenic
1053060388 9:35026231-35026253 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1053458837 9:38252756-38252778 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1053595933 9:39561801-39561823 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1053600240 9:39602755-39602777 TTCCATCTTGAATAGGGGCTGGG + Intergenic
1053802051 9:41770833-41770855 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1053853900 9:42318442-42318464 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1053857893 9:42356611-42356633 TTCCATCTTGAATAGGGGCTGGG + Intergenic
1054143216 9:61544456-61544478 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1054190430 9:61982528-61982550 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1054253286 9:62739629-62739651 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1054462926 9:65475337-65475359 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1054567403 9:66774128-66774150 TTCCATCTTGAATAGGGGCTGGG - Intergenic
1054570326 9:66803214-66803236 CTCCATCTTAAATAGGAGCTGGG - Intergenic
1054648035 9:67605598-67605620 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1054772107 9:69092646-69092668 CTTTATCTTAAATAGGAGCTGGG - Intronic
1055048437 9:71954839-71954861 CTCCATCTTGAATAGGAGCTGGG - Intronic
1055331485 9:75188335-75188357 CTCCATTTTGAATAGGGGCTGGG - Intergenic
1055379471 9:75690231-75690253 TTCCATCTTGAATAGGTGCTGGG - Intergenic
1055442710 9:76352470-76352492 CTTCATCTTGAATAGGGGCTGGG - Intronic
1055451746 9:76437192-76437214 CTCCATCTTGAATAGGAGCTGGG + Intronic
1055469158 9:76594355-76594377 CTCCATCTTGAATAGGAGCTAGG - Intergenic
1055518078 9:77053232-77053254 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1055567647 9:77585107-77585129 CTCCATCTTGAATAGGAGCTGGG - Intronic
1055701141 9:78947192-78947214 CTTCATCTTGAATAGGAGCTGGG - Intergenic
1055832521 9:80398004-80398026 CTCCATCTTGATTAGGGGCTGGG - Intergenic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1056391403 9:86144765-86144787 CTCCATCTTAAACAAGAGCTGGG + Intergenic
1056393978 9:86164744-86164766 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1056396195 9:86183567-86183589 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1056469846 9:86894724-86894746 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1056656498 9:88513965-88513987 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1056677815 9:88691168-88691190 TTCCATCTTGAATAGGGGCTGGG + Intergenic
1056726687 9:89125503-89125525 CTCCATCTTGAATAGGAGCTGGG + Intronic
1056746597 9:89309365-89309387 CTTCATCTTAAACAGGAGCTGGG - Intergenic
1056892341 9:90506757-90506779 CTCTATCTTGAATAGGAGCTGGG - Intergenic
1057142536 9:92736032-92736054 CTCCATCTTGAATAGGGACTGGG + Intronic
1057333333 9:94137138-94137160 CTCCATCCTGAATAGGAACTGGG + Intergenic
1057358584 9:94352527-94352549 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1057364092 9:94402215-94402237 CTCCATCTTGAATAGGAGCTGGG - Intronic
1057580174 9:96280646-96280668 CTCCATCTTAAATAGGAGCTGGG + Intronic
1057588121 9:96347678-96347700 CTCCATCTTAAATAGGAGCTGGG + Intronic
1057596727 9:96420875-96420897 CTCCATTTTAAAAAGGAGCTGGG + Intergenic
1057649167 9:96905083-96905105 CTCCATCTTGAATAGGAGCTGGG + Intronic
1057659244 9:96985846-96985868 CTCCATCTTGAATAGGAGCTGGG + Intronic
1057888758 9:98852149-98852171 CTCCATCTTGAACAGGGGCTGGG - Intergenic
1057943093 9:99301938-99301960 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1057988924 9:99747195-99747217 CTCCATCTTGAATAGGAGCAGGG + Intergenic
1058048668 9:100384462-100384484 CTCCATCTTAATTAGCAGCAGGG + Intergenic
1058071387 9:100603909-100603931 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1058247286 9:102643151-102643173 CTCCATCTTGAAAAGGAGCTGGG + Intergenic
1058291369 9:103244449-103244471 CTCCATCTTGAATAGAAGCTGGG - Intergenic
1058356105 9:104084902-104084924 CTCCATCTTGAATAGGGTCTGGG - Intergenic
1058455483 9:105134333-105134355 CTCCATCTTAAATAAGAGCTGGG + Intergenic
1058602228 9:106682670-106682692 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1058710627 9:107675953-107675975 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1058756209 9:108085121-108085143 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1058827780 9:108790283-108790305 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1059477315 9:114557868-114557890 CTCCATCTTGAATATGGGGCTGG - Intergenic
1060163459 9:121388340-121388362 CTCCATCTTTAATAGGGGCTGGG - Intergenic
1060172731 9:121475009-121475031 CTCCATCTTGAATGGGAGCTGGG + Intergenic
1060252849 9:122000055-122000077 CTCCATCTTAAATAGGATCTGGG + Intronic
1060499335 9:124141111-124141133 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1060681850 9:125573140-125573162 CTCCATCTTAAATAGGAGCTGGG + Intronic
1060859965 9:126946235-126946257 CTCAATCTTAATCAGGATCCAGG - Intronic
1060935573 9:127513378-127513400 CTGTATCTTAAATAGGAGCTGGG + Intronic
1061175137 9:128990856-128990878 CTCCATCTCAAAAATTAGCCAGG + Intronic
1061362227 9:130151013-130151035 CGCCATCTTGAATAGGGGCTGGG - Intergenic
1061636041 9:131908957-131908979 CTCCATCTTGAATAGGGGCTGGG - Intronic
1061987337 9:134137031-134137053 CTGCATCTTAAACACCAGCCGGG - Intronic
1062130490 9:134890023-134890045 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1062221908 9:135420862-135420884 CTCCATCTTGAACAGGGGCTGGG + Intergenic
1062222679 9:135426269-135426291 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1062548562 9:137075129-137075151 CTCCATCTTGAATGGGAGCTGGG + Intergenic
1185590115 X:1270738-1270760 CTCCATCTAGAATAGGGGCTGGG - Intronic
1185702590 X:2242453-2242475 CTCCATCTTGAATAGGGGCTGGG + Intronic
1185743083 X:2549548-2549570 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1185743698 X:2554601-2554623 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1185749455 X:2599144-2599166 CTCAATCTTGAATAGGAGCTGGG - Intergenic
1185750169 X:2604549-2604571 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1185769607 X:2755600-2755622 CTCCATCTTGAATAGGGGCTGGG - Intronic
1185785803 X:2890013-2890035 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1185786019 X:2891597-2891619 CTCCATCTTGAATAGGGCCTGGG - Intergenic
1185817306 X:3168297-3168319 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1185819211 X:3185399-3185421 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1185823580 X:3227674-3227696 CTCTATCTTGAATAGGGGCTGGG + Intergenic
1185841780 X:3398719-3398741 CTCCATCTTGAATAGGAGCTAGG + Intergenic
1185859787 X:3566872-3566894 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1185860135 X:3570836-3570858 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1185868131 X:3640662-3640684 CTCCATCCTGAACAGGGGCCGGG + Intronic
1185875824 X:3701603-3701625 CTCCATCTTGAAGAGGAGCTGGG + Intronic
1185886651 X:3789318-3789340 CTCCATCTTAACTAGGAGCTGGG - Intergenic
1185929106 X:4182235-4182257 CTCCATCTTGAACAGGGGGCTGG - Intergenic
1185955483 X:4484392-4484414 CTCCATCTTAAATAGGGGCTGGG + Intergenic
1185959818 X:4537385-4537407 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1185972029 X:4675867-4675889 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1185983227 X:4802883-4802905 CTCCATCTTGAATAGGGGCTAGG + Intergenic
1186056108 X:5651268-5651290 CTCCATCTTACATCGGGGCTGGG - Intergenic
1186089047 X:6024432-6024454 CTCCATCTTGAATAAGGGCTGGG + Intronic
1186116045 X:6306305-6306327 CCCCATCTTGAATAGGGGCTGGG - Intergenic
1186182384 X:6985814-6985836 CTCCATCTTGAATAGGATCTGGG + Intergenic
1186185710 X:7017789-7017811 CTGCATCTTGAATAGGAGCAGGG + Intergenic
1186602896 X:11057251-11057273 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG + Exonic
1186830587 X:13386263-13386285 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1186833484 X:13414438-13414460 CTCCATCTTGGATAGGGGCTGGG - Intergenic
1186883516 X:13890014-13890036 CTCCATCTTAAATAGGAGCTGGG + Intronic
1187070571 X:15883437-15883459 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1187140220 X:16586098-16586120 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1187150527 X:16677555-16677577 CTCCATCTTGAATAGGGGCTGGG + Intronic
1187179621 X:16931670-16931692 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1187306053 X:18096282-18096304 CTCCTTCTTGAATAGGGGCTGGG - Intergenic
1187417117 X:19102992-19103014 CTCCATCTTGAATAGGGACTGGG + Intronic
1188126265 X:26373325-26373347 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1188126592 X:26375606-26375628 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1188133694 X:26468867-26468889 TTCCATCTTGAATAGGAGCTAGG - Intergenic
1188213161 X:27446980-27447002 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1188284329 X:28309997-28310019 CTCCATCTTGAATAGGGTCAGGG + Intergenic
1188336042 X:28934155-28934177 CTCCATTTTGACTAGGAGCTGGG - Intronic
1188433964 X:30139314-30139336 CTCCATCTTAAATAGTAGCTGGG - Intergenic
1188626313 X:32289444-32289466 CTCCATCTTGAATAGGGGCTGGG + Intronic
1189086178 X:38026893-38026915 TGCCATCTTAAATAGGAGCTGGG - Intronic
1189274468 X:39775423-39775445 CTCCATCTCAAAAAAAAGCCAGG + Intergenic
1189419788 X:40846631-40846653 CCCCATCTTAAATAGGGGCTGGG - Intergenic
1189433743 X:40972720-40972742 CTCTATCTTGAATAGGAACTGGG + Intergenic
1189480678 X:41390114-41390136 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1189691075 X:43617369-43617391 CTCCATCTGGAATAGGGGCTGGG - Intergenic
1189733391 X:44045310-44045332 CTCCATGTTGAATAGGGGCTGGG + Intergenic
1189743281 X:44143365-44143387 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1189834888 X:45009578-45009600 CTCCATCTTGAATAGGGGCTGGG - Intronic
1189953799 X:46258297-46258319 CTCCATCTTGAATACGGGCTGGG + Intergenic
1189965546 X:46368783-46368805 CTCCATTTTGAATAGGGGCTGGG - Intergenic
1190010027 X:46776414-46776436 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1190137452 X:47809569-47809591 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1190465474 X:50721689-50721711 CTCCATCTTGAATAGAAGCTGGG - Intronic
1190815065 X:53922658-53922680 CTCCATCTTAAATAGGAGCTGGG + Intergenic
1190815833 X:53928404-53928426 CTCTATCTTAAATAGGAGCTGGG + Intergenic
1190920318 X:54845316-54845338 CTCCATCTTGAATGGGAACTGGG - Intergenic
1190947589 X:55110910-55110932 CCCCATCTTGAATTGGAGCTGGG + Intronic
1190963548 X:55276455-55276477 CTGCATTTTAAATAGGAGCTGGG + Intronic
1191006034 X:55712362-55712384 CTCCATCTTTAGTAGGGGCTGGG - Intergenic
1191119299 X:56886928-56886950 CTACATCTTGAATAGGGGCTGGG + Intergenic
1191617595 X:63186204-63186226 CTCCATCTTGATTAGGGGCTGGG + Intergenic
1191636637 X:63384738-63384760 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1191636818 X:63387545-63387567 CTCCATCTTGAATAGGCGCTGGG + Intergenic
1191822876 X:65332096-65332118 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1191844773 X:65538873-65538895 CTCCATCCTGAATAGGGGCTGGG + Intergenic
1192121668 X:68462335-68462357 CTCCATCTTTAATAGGTGCTGGG + Intergenic
1192498251 X:71630931-71630953 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1192542251 X:71984018-71984040 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1192888326 X:75361669-75361691 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1192888857 X:75366673-75366695 CTCCATCTTGAATATGGGCTGGG + Intergenic
1193697924 X:84731237-84731259 CTCCATCTTGAGTAGGGGCTGGG - Intergenic
1193883181 X:86951883-86951905 CTCCATCTTAAGTAGGAGCTGGG - Intergenic
1193986210 X:88243442-88243464 CACCATCTTGAATAGGAGGTGGG - Intergenic
1194041544 X:88947345-88947367 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1194296735 X:92134994-92135016 CTCCATCTTGAATAGGGGCTGGG - Intronic
1194702241 X:97128502-97128524 CTCCATCTTAAATAGGAGCTGGG - Intronic
1194803082 X:98295351-98295373 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1194896450 X:99447402-99447424 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1194997860 X:100611316-100611338 CTCCATCTTGAATAGGAGCTGGG - Intergenic
1194997930 X:100612086-100612108 CTCCATCTTGAATAGGGGATGGG + Intergenic
1196132121 X:112168410-112168432 CTCCATCTTGAATAGGAACTGGG + Intergenic
1196368090 X:114945636-114945658 CTCCATCTTAAATAGGGGCTGGG + Intergenic
1196373032 X:115000059-115000081 CTCCATCTTGAATAGGGACTGGG + Intergenic
1197351269 X:125386469-125386491 CTCCATCTTGAATAGAGGCTGGG + Intergenic
1197464540 X:126786265-126786287 CTTCATCTTGAATAGGGGCTGGG - Intergenic
1197738987 X:129874788-129874810 CTCCATCCTGAATAGGGGCTGGG + Intergenic
1198454742 X:136805468-136805490 CTCCATCTTGAATAGGAGCAGGG + Intergenic
1198497949 X:137212795-137212817 CTCCATCTTGAATAGGAGCTGGG + Intergenic
1198577580 X:138026720-138026742 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1198761433 X:140036824-140036846 CTCCATTTTGAATAGGAGATGGG - Intergenic
1198832934 X:140770141-140770163 CTCCATCTTGAGTAGGGGCTGGG + Intergenic
1198845004 X:140900867-140900889 CACCATCTTGAATAGGAGCTGGG - Intergenic
1198847021 X:140923291-140923313 CTCCATCTTGAATAGGGACTGGG - Intergenic
1199367206 X:147001005-147001027 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1199545305 X:149002473-149002495 CTCTATCTTGAATAGGGGCTAGG + Intergenic
1199559486 X:149147280-149147302 CTCCACCTTAACTGGCAGCCTGG - Intergenic
1199994314 X:153010623-153010645 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1200148620 X:153940516-153940538 CTCCATCTTAAACAGGAGCTGGG + Intronic
1200614250 Y:5359572-5359594 CTCCATCTTGAATAGGGGCTGGG - Intronic
1200775613 Y:7167586-7167608 CTCCATCTTAACTAGGAGCTGGG + Intergenic
1200777880 Y:7185933-7185955 CTCCATCTTGAATAGGGACTGGG + Intergenic
1200785977 Y:7260786-7260808 CTCCATCTTGAATAAGGGCTGGG + Intergenic
1201261150 Y:12160173-12160195 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1201288054 Y:12395807-12395829 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1201300905 Y:12504029-12504051 CTCCATCTTGAATAGGGGCTGGG + Intergenic
1201328856 Y:12796984-12797006 TTCCATCTTGAATAGGGGCTAGG - Intronic
1201537661 Y:15068353-15068375 CTCCATCTTGAAGAGGAACTGGG + Intergenic
1201668820 Y:16491842-16491864 CTCCATCTTGAATAGGCACTGGG - Intergenic
1201702245 Y:16896767-16896789 CTCCATCTTGAATAGGGGCTGGG - Intergenic
1201912352 Y:19145676-19145698 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1202302160 Y:23428225-23428247 CTCTATCTTGAATAGGGGCTGGG - Intergenic
1202304902 Y:23458737-23458759 CTTCATCTTGAATAGGGGCTGGG - Intergenic
1202565908 Y:26211853-26211875 CTTCATCTTGAATAGGGGCTGGG + Intergenic
1202568651 Y:26242373-26242395 CTCTATCTTGAATAGGGGCTGGG + Intergenic