ID: 1135325636

View in Genome Browser
Species Human (GRCh38)
Location 16:21523745-21523767
Sequence CAATGTGTGCAGAGGGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135325625_1135325636 23 Left 1135325625 16:21523699-21523721 CCCAGGGCTGGCCGAATGCCTGG No data
Right 1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG No data
1135325629_1135325636 5 Left 1135325629 16:21523717-21523739 CCTGGCTTCCACCCTCAGACTTT No data
Right 1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG No data
1135325627_1135325636 22 Left 1135325627 16:21523700-21523722 CCAGGGCTGGCCGAATGCCTGGC No data
Right 1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG No data
1135325632_1135325636 -7 Left 1135325632 16:21523729-21523751 CCTCAGACTTTCTTTCCAATGTG No data
Right 1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG No data
1135325628_1135325636 12 Left 1135325628 16:21523710-21523732 CCGAATGCCTGGCTTCCACCCTC No data
Right 1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG No data
1135325631_1135325636 -6 Left 1135325631 16:21523728-21523750 CCCTCAGACTTTCTTTCCAATGT No data
Right 1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG No data
1135325630_1135325636 -3 Left 1135325630 16:21523725-21523747 CCACCCTCAGACTTTCTTTCCAA No data
Right 1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135325636 Original CRISPR CAATGTGTGCAGAGGGAACA CGG Intergenic
No off target data available for this crispr