ID: 1135328433

View in Genome Browser
Species Human (GRCh38)
Location 16:21542639-21542661
Sequence CACCAGGTCCAGGGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135328433_1135328441 -1 Left 1135328433 16:21542639-21542661 CCCTGGATCCCCTGGACCTGGTG No data
Right 1135328441 16:21542661-21542683 GGGCTGTTTCCAGCTCCACAAGG No data
1135328433_1135328444 14 Left 1135328433 16:21542639-21542661 CCCTGGATCCCCTGGACCTGGTG No data
Right 1135328444 16:21542676-21542698 CCACAAGGCAGCCAATTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135328433 Original CRISPR CACCAGGTCCAGGGGATCCA GGG (reversed) Intergenic
No off target data available for this crispr