ID: 1135329037

View in Genome Browser
Species Human (GRCh38)
Location 16:21545887-21545909
Sequence GGGCTGGTCCAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135329037_1135329041 -4 Left 1135329037 16:21545887-21545909 CCCAGCTCCATCTGGACCAGCCC No data
Right 1135329041 16:21545906-21545928 GCCCGCACCATTGTTAACACAGG No data
1135329037_1135329046 26 Left 1135329037 16:21545887-21545909 CCCAGCTCCATCTGGACCAGCCC No data
Right 1135329046 16:21545936-21545958 CTCATCCTTCCGCACATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135329037 Original CRISPR GGGCTGGTCCAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr