ID: 1135337222

View in Genome Browser
Species Human (GRCh38)
Location 16:21613265-21613287
Sequence TACTTAAACCCGGGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135337222_1135337231 17 Left 1135337222 16:21613265-21613287 CCTCCGCCTCCCGGGTTTAAGTA No data
Right 1135337231 16:21613305-21613327 TCCCAAGTAGCTGGGATTACAGG 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467
1135337222_1135337227 8 Left 1135337222 16:21613265-21613287 CCTCCGCCTCCCGGGTTTAAGTA No data
Right 1135337227 16:21613296-21613318 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
1135337222_1135337229 9 Left 1135337222 16:21613265-21613287 CCTCCGCCTCCCGGGTTTAAGTA No data
Right 1135337229 16:21613297-21613319 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135337222 Original CRISPR TACTTAAACCCGGGAGGCGG AGG (reversed) Intronic
No off target data available for this crispr