ID: 1135341967

View in Genome Browser
Species Human (GRCh38)
Location 16:21656181-21656203
Sequence CAGCATTAACTGGGGGGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135341967_1135341976 2 Left 1135341967 16:21656181-21656203 CCCCACCCCCCCAGTTAATGCTG 0: 1
1: 0
2: 0
3: 13
4: 232
Right 1135341976 16:21656206-21656228 GTGAAAAATGCAAAATAACCTGG 0: 1
1: 0
2: 1
3: 44
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135341967 Original CRISPR CAGCATTAACTGGGGGGGTG GGG (reversed) Exonic
900076086 1:818962-818984 CAGCATTAACTCTGGGAGTTGGG + Intergenic
900172507 1:1275869-1275891 CAGGATAAATTGGGGTGGTGTGG + Intergenic
900759886 1:4463473-4463495 GAGCACTAACTGTGGGAGTGGGG - Intergenic
903033944 1:20482354-20482376 CTGCTTTGGCTGGGGGGGTGGGG - Intergenic
904032349 1:27541065-27541087 GAGAATGAACTGGGGGGCTGGGG + Intronic
905450533 1:38053281-38053303 CAGCACCTGCTGGGGGGGTGTGG + Intergenic
906046672 1:42836385-42836407 CAGCACTCACTGGGGAGTTGAGG + Intronic
906333795 1:44910611-44910633 AAGCATTACTTGGGGGGGTGGGG - Intronic
906552555 1:46677576-46677598 CAGACTTAAGTGGGTGGGTGGGG + Exonic
907316701 1:53577052-53577074 CAGCATTTATTGGGGGAGGGAGG - Intronic
907501812 1:54886766-54886788 CAGGACTTCCTGGGGGGGTGGGG - Intronic
910161324 1:84275747-84275769 CAATATTCACTGTGGGGGTGTGG + Intergenic
911594262 1:99782682-99782704 CAGCATTCAATGTGGGGGTTTGG - Intergenic
912078858 1:105911288-105911310 CAGCAAAAACTTGGGGTGTGAGG - Intergenic
912454386 1:109788044-109788066 CAGCATGAGCTGGGGCGGCGCGG + Intergenic
913659936 1:120997853-120997875 TAGCATAAACATGGGGGGTGGGG - Intergenic
914011293 1:143781004-143781026 TAGCATAAACATGGGGGGTGGGG - Intergenic
914166541 1:145180132-145180154 TAGCATAAACATGGGGGGTGGGG + Intergenic
916226063 1:162490489-162490511 CTGCTTGAACTGGGGAGGTGGGG + Intergenic
917305862 1:173623937-173623959 CAACATACACTGTGGGGGTGGGG + Intronic
920535377 1:206733593-206733615 CAGCACTAAGTGGGGGGAGGGGG - Exonic
922338540 1:224637381-224637403 GAGAACTAACTTGGGGGGTGGGG - Intronic
1064006430 10:11702830-11702852 CAGCATCAAATGGGGGGTTTGGG + Intergenic
1069976400 10:72216483-72216505 CAGCTGTAACGGGGGGGGGGGGG - Intronic
1071839163 10:89451222-89451244 CAGCAGCAACTGGGGAGGAGAGG - Intronic
1073231179 10:101971611-101971633 CAGGATTAATTGGGAGGCTGTGG + Intronic
1073978097 10:109123217-109123239 ATGCATTAACTGGCCGGGTGCGG + Intergenic
1075824340 10:125341942-125341964 CAGCATTCACTGGGGTGCAGGGG + Intergenic
1075974514 10:126683850-126683872 CAGCATTAGTGGCGGGGGTGGGG + Intergenic
1076034800 10:127190671-127190693 CAGCAGGAACGGGGGGGGGGGGG - Intronic
1077712660 11:4552185-4552207 CAGCAAAAACTTGGGGTGTGAGG - Intergenic
1079022906 11:16924059-16924081 CAGCCTTAAATGGAGGGCTGTGG - Intronic
1079358496 11:19750566-19750588 CAGCATTAACAGAGTGGGTGAGG - Intronic
1079372679 11:19864916-19864938 CAGCATTAGCTGGGGTAGAGGGG - Intronic
1080380639 11:31768847-31768869 CAGCCCTATCTGGGGGTGTGGGG + Intronic
1081533241 11:43978868-43978890 CAGCATCAACTGGTCGGGTAAGG + Intergenic
1081658754 11:44874980-44875002 CAGCATTAAATTGGGGGCAGAGG + Intronic
1084574649 11:69981259-69981281 CAGCAGTAAGTGGGAGAGTGGGG - Intergenic
1084659019 11:70536252-70536274 CAGCTGTAAGTGGCGGGGTGTGG + Intronic
1084737842 11:71117308-71117330 CAGAAATAACTGGCTGGGTGAGG - Intronic
1085285928 11:75360866-75360888 CTGCATTAAGGGGCGGGGTGCGG + Intergenic
1085408224 11:76276779-76276801 CAGGACCAACTGGGGGGTTGGGG - Intergenic
1087667066 11:101062986-101063008 CAACAATCACTGGGTGGGTGAGG + Intronic
1087792974 11:102426862-102426884 GAGCAATAAATGGGGGGGGGGGG - Intronic
1088304303 11:108391744-108391766 GAGAATTAACTGGGGGGAGGGGG - Intronic
1088547089 11:110970135-110970157 AGGAATTAACTGGGGGGGGGCGG - Intergenic
1089167804 11:116490676-116490698 AAGAATTAACAGGTGGGGTGTGG - Intergenic
1089318393 11:117607604-117607626 CAGCCTTCACTGGGGAGCTGTGG - Intronic
1090382011 11:126333989-126334011 CAGAATTAATTGGTGGAGTGGGG + Intronic
1092870020 12:12797970-12797992 CAGCATTAACAAGGGAGTTGGGG - Intronic
1097878609 12:64667087-64667109 CTGCAAGAAATGGGGGGGTGTGG + Intronic
1102508639 12:113399519-113399541 CAGCATTATCTGGGCAGGGGTGG - Intronic
1102901165 12:116638332-116638354 CATCTTTAACTGGATGGGTGTGG - Intergenic
1103816327 12:123659836-123659858 CAACATGAACTGGGGGTGGGAGG - Exonic
1105209970 13:18251991-18252013 CAGGACTACCTCGGGGGGTGAGG - Intergenic
1106149929 13:27089520-27089542 AAGCAGAAACTGGGGGTGTGGGG + Intronic
1107930120 13:45300131-45300153 CAGAAATAACTGTGGAGGTGTGG - Intergenic
1108076078 13:46680930-46680952 CAGGAGTAGCTGGGGGTGTGTGG + Intronic
1108762675 13:53588652-53588674 CAAAATGAACTGGGGTGGTGTGG - Intergenic
1110555887 13:76858442-76858464 CAGCTTTTTCTGGGGGGGAGGGG + Intergenic
1110973689 13:81801435-81801457 CATCATTAAATGGGGTTGTGTGG - Intergenic
1111181052 13:84665346-84665368 CAACATTAGCCGGGGTGGTGGGG + Intergenic
1117823499 14:59675966-59675988 CAGCATTAAATGGGGAGTGGGGG - Intronic
1118900210 14:69980054-69980076 CAGCTGGAAGTGGGGGGGTGAGG + Intronic
1120504790 14:85341915-85341937 CATCATTAATGGGGGGAGTGTGG - Intergenic
1121618834 14:95332238-95332260 CAGCAATAGGTGGGGGTGTGGGG + Intergenic
1122258389 14:100497822-100497844 CAGCATCACCTGGCGGGGGGAGG - Intronic
1122340600 14:101025842-101025864 TAACATCAACTGCGGGGGTGGGG + Intergenic
1122892274 14:104738286-104738308 CAGCATGAAATGGGTGGGTGCGG - Intronic
1123753946 15:23381824-23381846 CAGCATCGAGTGGGGGGCTGGGG - Intergenic
1123757788 15:23410430-23410452 CAGCAAGAACTGGAGGGCTGTGG + Intergenic
1124465940 15:29939928-29939950 TATCATAAACTGGGGGGTTGGGG - Intronic
1125982656 15:44017046-44017068 AAGCATGAACTGGCCGGGTGCGG + Intronic
1128260001 15:66226732-66226754 CAGCATCCACTGGGGGGGCTTGG + Intronic
1128744172 15:70102080-70102102 TAGAATCAACTGAGGGGGTGTGG - Intergenic
1129058389 15:72838872-72838894 CGGTAGTAACTGGGGAGGTGGGG - Intergenic
1129707062 15:77800295-77800317 CAGCAGTAACTAGGGACGTGAGG - Intronic
1132684887 16:1158198-1158220 CAGGATCAGCTGTGGGGGTGGGG - Intronic
1133337761 16:5017213-5017235 CACCCTTAACAGTGGGGGTGAGG + Exonic
1133402901 16:5501827-5501849 CAGCATGTACTGGGAGGCTGAGG - Intergenic
1134462432 16:14441203-14441225 CAGCATCAAGTTGGGGGCTGGGG + Intronic
1134589383 16:15439952-15439974 TAGCATCAACTGGCTGGGTGTGG + Intronic
1135341967 16:21656181-21656203 CAGCATTAACTGGGGGGGTGGGG - Exonic
1136143903 16:28304290-28304312 CAGCATTAAGTGCGAGGCTGGGG - Intronic
1137427021 16:48388216-48388238 CAGCATTATCTGAGAGGCTGAGG - Intronic
1138198759 16:55073689-55073711 CAGGATTCAGTGGGGGGGGGGGG + Intergenic
1139650612 16:68360308-68360330 CAGCATAAACGGGGGTGGGGGGG - Exonic
1140523554 16:75603076-75603098 CAGCATCACCTGAGGGAGTGTGG + Exonic
1143107365 17:4536422-4536444 CAGCAGTGAGTGGGGGGGAGGGG + Exonic
1143710922 17:8734949-8734971 CAGGATCACCTGGGAGGGTGAGG - Intronic
1145239544 17:21232188-21232210 CAGCATTAGATGGGGAGGTCAGG + Intergenic
1146151553 17:30477448-30477470 CAGCAGTTACTGGGAAGGTGAGG + Exonic
1146386732 17:32383610-32383632 CAACATTAACTGCCTGGGTGTGG + Intergenic
1147586891 17:41658009-41658031 CAGCATTTCCTGGGGGTGTCCGG - Intergenic
1148671539 17:49414389-49414411 CTGGAATAACTGGGAGGGTGGGG + Intronic
1148772795 17:50076730-50076752 CCTCATTAACTGGCAGGGTGGGG + Intronic
1151925437 17:77192616-77192638 CAGAATTAAATGGGTGGCTGGGG - Intronic
1152520807 17:80855559-80855581 CCGCATTAACCTGGGGGCTGAGG + Intronic
1154058642 18:11036425-11036447 CAGCTTTACCGGGGGAGGTGGGG - Intronic
1156479982 18:37430236-37430258 CAGCATTGACTGAGTGGATGGGG - Intronic
1157617704 18:48997032-48997054 CAGCAGTGTCTGGGGGGGTAGGG - Intergenic
1158422311 18:57306128-57306150 CTGCATTAATTGTGGGTGTGTGG + Intergenic
1158472085 18:57746046-57746068 CAGTATTAACCGTGGGGGTGAGG + Intronic
1159754865 18:72351707-72351729 CATCAGCAACTGGGGGAGTGAGG - Intergenic
1162965741 19:14155239-14155261 CAGCACTCACTGGGGGCTTGAGG + Intronic
1166897360 19:46032447-46032469 CAGCTATGCCTGGGGGGGTGGGG - Intergenic
1167593883 19:50417678-50417700 CAGCAGGCACGGGGGGGGTGGGG - Intronic
1168538649 19:57192221-57192243 CAGCATGAATTGGGGGCCTGAGG + Intronic
925012818 2:498384-498406 CTGCAGTAACTCGGGGAGTGTGG + Intergenic
925341432 2:3140591-3140613 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341440 2:3140648-3140670 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341457 2:3140763-3140785 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341465 2:3140820-3140842 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341474 2:3140877-3140899 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341482 2:3140934-3140956 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341499 2:3141047-3141069 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341540 2:3141384-3141406 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341549 2:3141441-3141463 CAGCATTGATTGAGGGGCTGTGG - Intergenic
925341564 2:3141556-3141578 CAGCATTGATTGAGGGGCTGTGG - Intergenic
927148238 2:20180670-20180692 CAGCACTATGTGTGGGGGTGGGG + Intergenic
928956630 2:36876016-36876038 CAGCATTTAGTGGGAGGCTGAGG + Intronic
931776571 2:65546036-65546058 CATCATTAGCAGGGGAGGTGGGG - Intergenic
933207300 2:79521850-79521872 CAGCATGAACTGGAGGGGCAGGG + Intronic
935958447 2:108400921-108400943 CAGCAATAACTCAGGGTGTGAGG - Intergenic
941137798 2:161739098-161739120 CTGCATCAAGTGGGTGGGTGGGG + Intronic
942618970 2:177827045-177827067 CAGCAGCCACTGTGGGGGTGCGG + Intronic
944581572 2:201137136-201137158 CACCATTTCCTGGGGGGCTGGGG + Intronic
946493270 2:220170744-220170766 CAGGGTTGGCTGGGGGGGTGTGG + Intergenic
947056177 2:226107258-226107280 AAGAATTAAATGGGGGGGTGGGG + Intergenic
948044481 2:234932978-234933000 GATCATTAACTGTGGGCGTGTGG + Intergenic
948070332 2:235116246-235116268 CAGCATCAGGTGGGGGTGTGCGG - Intergenic
948763016 2:240204252-240204274 CAGCATTACCAGGGGGAGTCGGG - Intergenic
949071998 2:242030977-242030999 CAGGGTGAAGTGGGGGGGTGTGG - Intergenic
1168804021 20:662393-662415 GACCCTCAACTGGGGGGGTGAGG - Exonic
1169334894 20:4748139-4748161 CAGCACTGACTGGGAGGCTGAGG - Intergenic
1169345253 20:4823697-4823719 CAGCATTGTCTGGGAGGGAGGGG - Intergenic
1171226133 20:23443556-23443578 CAGAAGGGACTGGGGGGGTGGGG + Intronic
1172339117 20:34142492-34142514 TTGCTTGAACTGGGGGGGTGGGG - Intergenic
1172991209 20:39038373-39038395 CAGCATTTACTGGGAAGGTGTGG + Intronic
1173224826 20:41156306-41156328 CAGCATTCACTGTGGGCTTGGGG + Intronic
1173836010 20:46126213-46126235 CATTATTTACTGGGGGTGTGGGG - Intronic
1173979142 20:47209256-47209278 CTGAAAAAACTGGGGGGGTGGGG + Intronic
1174052264 20:47774998-47775020 CAGGATTTACTGGGGGGCTCAGG - Intronic
1175747097 20:61464785-61464807 CAGCATCCACTGGGGGGTGGAGG + Intronic
1179312488 21:40209045-40209067 CAGGATTAATTGTAGGGGTGAGG + Intronic
1180536148 22:16394462-16394484 AAGCATTAACTGGTGGGGGAGGG + Intergenic
1180766290 22:18347412-18347434 CAGGACTACCTCGGGGGGTGAGG + Intergenic
1180780023 22:18514966-18514988 CAGGACTACCTCGGGGGGTGAGG - Intergenic
1180812739 22:18772287-18772309 CAGGACTACCTCGGGGGGTGAGG - Intergenic
1181108958 22:20590392-20590414 CAGCAACAACTGTGGGGATGGGG - Intergenic
1181198897 22:21206535-21206557 CAGGACTACCTCGGGGGGTGAGG - Intergenic
1181400842 22:22649254-22649276 CAGGACTACCTCGGGGGGTGAGG + Intergenic
1181648547 22:24246650-24246672 CAGGACTACCTCGGGGGGTGAGG - Intergenic
1181702823 22:24630352-24630374 CAGGACTACCTCGGGGGGTGAGG + Intergenic
1182122365 22:27796444-27796466 CAGCTAAAACTGGGGGTGTGGGG + Intronic
1182133668 22:27880060-27880082 GAGCATTAACTGGGAGAATGTGG - Intronic
1182354365 22:29715751-29715773 GAGCAGAAACTTGGGGGGTGGGG - Intergenic
1183742664 22:39677467-39677489 CAGGAGGAACTGGGGGGGCGGGG + Intronic
1184710856 22:46248607-46248629 CAGCGTTCACTGGGGGCTTGTGG - Intronic
1185053636 22:48566663-48566685 CAGCAATACGTTGGGGGGTGGGG + Intronic
1203227908 22_KI270731v1_random:88302-88324 CAGGACTACCTCGGGGGGTGAGG + Intergenic
949259450 3:2088201-2088223 AAGCATTAATTGGCTGGGTGCGG - Intergenic
950283039 3:11723173-11723195 CAGGATTACCTGGGTGGGGGTGG + Intergenic
950831578 3:15879923-15879945 CACCATTTCCTGGGGGGCTGGGG - Intergenic
954038791 3:47868650-47868672 CAGCATCAACTGGAGGGCAGAGG - Intronic
954661959 3:52231117-52231139 CCGCATTAACGAGGTGGGTGGGG - Exonic
956251373 3:67237675-67237697 CAGCATTCCCAGGGGAGGTGAGG - Intergenic
959198650 3:103218199-103218221 CAGCTTTAAATGGGGGGGGGGGG + Intergenic
959441717 3:106384405-106384427 CAGCATCACCTGGAGGGCTGTGG - Intergenic
961106190 3:124243592-124243614 CAGCATTGACTTGGTGGGAGTGG + Intronic
962357767 3:134709477-134709499 CAGAAATAACTGGGGGGTGGGGG + Intronic
963847811 3:150177765-150177787 CAGGGTTAGCTGGTGGGGTGTGG + Intergenic
964371617 3:156005819-156005841 CAGCATTGGGTGGTGGGGTGGGG + Intergenic
964791206 3:160454017-160454039 CAGCAATAATTTGGGGGTTGAGG + Intronic
967100177 3:186209888-186209910 GAGGATTAGCTGGGGGAGTGGGG - Intronic
967119909 3:186373674-186373696 CAGCACAAACTGGCCGGGTGTGG - Intergenic
969880573 4:10170113-10170135 CAGCAGTTACTGGGGGGGGGGGG + Intergenic
972302483 4:37797873-37797895 CAGTCCTAACTGGGGGGGGGGGG + Intergenic
972385181 4:38559168-38559190 CAGCATTAATTAGGGGTGAGAGG + Intergenic
972591709 4:40494228-40494250 AAGCAGTGACTGGGGAGGTGGGG - Intronic
972602273 4:40583176-40583198 CAGCATTTACTGGGAGGCTGAGG + Intronic
974812214 4:66959139-66959161 CAGCAGTAGCTGGAGGGGTGTGG + Intergenic
977060592 4:92253818-92253840 CAGAATTTGCTGGAGGGGTGGGG - Intergenic
978002397 4:103572501-103572523 CAGCATTCACTTGGTGGGAGTGG - Intergenic
978283324 4:107043767-107043789 CAGTGTTAAGTGGTGGGGTGAGG - Intronic
979171555 4:117606717-117606739 CAGCATTTAATGTGGGAGTGTGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
986449737 5:7852074-7852096 CAGCAGGAAGTGGGGTGGTGTGG + Intronic
987245384 5:16043030-16043052 AAGCATTAAGGTGGGGGGTGGGG + Intergenic
991389024 5:66122658-66122680 CAGCAATAACTGGAGGAATGAGG - Intergenic
991471126 5:66970139-66970161 CAGCTGTCACTGGGGTGGTGTGG + Intronic
992303152 5:75405862-75405884 CTGCAGTTACTGGGGGGGGGGGG + Intronic
995860742 5:116637791-116637813 CAGCATTAACTTGGGACATGTGG + Intergenic
997038863 5:130227570-130227592 TGGCAATAACTGGGGGGTTGAGG + Intergenic
997729584 5:136157810-136157832 GAGCATGAACTGGGGGGGTTAGG + Intronic
998726189 5:145017426-145017448 CAACATTTACTGGGTGGCTGTGG - Intergenic
1004731791 6:18366357-18366379 CACCATTTCCTGGGGGGCTGAGG + Intergenic
1004976105 6:20968447-20968469 CAGCACTAATTGGCTGGGTGCGG - Intronic
1006364824 6:33609113-33609135 TAGCATTGCCTGGGAGGGTGGGG + Intergenic
1007319561 6:41017757-41017779 CAGCAGTGACTGGGTGGGTGAGG - Intergenic
1007975693 6:46098969-46098991 CAGCACTGGCTGCGGGGGTGGGG + Intergenic
1010188528 6:73169816-73169838 CAGTTTTAAGTGGTGGGGTGAGG - Exonic
1014919085 6:127191337-127191359 CAAAATAAACTGGGGGGGAGGGG + Intronic
1015508485 6:134013937-134013959 CAGCTATAACTGGGGAGATGGGG + Intronic
1016913876 6:149226452-149226474 CAGCAGTATCTGCGGAGGTGGGG - Intronic
1017192560 6:151669492-151669514 CAGCACAACCTGGGGAGGTGGGG + Intronic
1017647624 6:156553603-156553625 CAGCATAATCCGGGTGGGTGAGG + Intergenic
1018457235 6:163963185-163963207 CTGTATTAATTGGGGGGGGGGGG + Intergenic
1019042618 6:169119298-169119320 CAGCAAAAACTTGGGGTGTGAGG - Intergenic
1020072129 7:5234049-5234071 AAAAATTAGCTGGGGGGGTGGGG + Intergenic
1021005861 7:15393924-15393946 AAGTATGAACTGGTGGGGTGGGG - Intronic
1021565899 7:22016094-22016116 CAGCATCAAATTGGGGAGTGAGG + Intergenic
1022498213 7:30866345-30866367 CAGCCTCAACTGTGTGGGTGGGG + Intronic
1023517836 7:41019686-41019708 CAGCCTTAGCTGGGGTTGTGAGG - Intergenic
1028640677 7:93039404-93039426 CAGCAGCACCTGGGAGGGTGGGG - Intergenic
1033097330 7:138442581-138442603 CACCATTTCCTGGGGGGCTGGGG - Intergenic
1033261129 7:139844978-139845000 CAGCATAGCCTGGGGGGCTGGGG - Intronic
1036579823 8:10063551-10063573 CCCCATCACCTGGGGGGGTGAGG - Intronic
1037806221 8:22059112-22059134 CCACAGTAACTGCGGGGGTGGGG + Intronic
1038006160 8:23432427-23432449 CAGCATTAAATTGAGGAGTGGGG - Exonic
1039039256 8:33391802-33391824 CAGAATTAACTGGGGGGATCAGG + Intronic
1039790592 8:40872656-40872678 GGGCATTATCTGAGGGGGTGTGG - Intronic
1040538076 8:48326995-48327017 CAGCATGAAGTGGGGTGGGGTGG + Intergenic
1040847570 8:51859920-51859942 GAGCATTATTTAGGGGGGTGGGG - Intronic
1045159812 8:99526092-99526114 CAGAAAGAAATGGGGGGGTGGGG + Intronic
1053027497 9:34741888-34741910 TAGTTTTAAATGGGGGGGTGGGG + Intergenic
1054451752 9:65407021-65407043 CAGCAAAAACTGGGGTGATGTGG - Intergenic
1055920906 9:81459891-81459913 CAGCATTATGTGGGGGGCAGGGG - Intergenic
1057018964 9:91681121-91681143 CAGCACTCACTGGGAGGCTGCGG + Intronic
1057825609 9:98370207-98370229 CAGGACTAGCTGGAGGGGTGAGG + Intronic
1060740274 9:126093287-126093309 CAGTATCATCTGGTGGGGTGCGG - Intergenic
1061602277 9:131679053-131679075 CAGCAGTGACTGGGGGTGGGGGG + Intronic
1186171098 X:6877839-6877861 CAGCATTACTTGAGGGAGTGGGG - Intergenic
1186516563 X:10170676-10170698 CAGCATTACCAGGAGGGCTGGGG - Intronic
1186860028 X:13663815-13663837 CAGCATAAACTGGGAGACTGTGG + Intronic
1189055335 X:37693758-37693780 CTGCTTTAACTGGGGTGGTTTGG + Intronic
1189136188 X:38552638-38552660 CAGCATTAAGTGATGGGTTGTGG - Intronic
1195361642 X:104087921-104087943 CAGCTTTAGCTGTGTGGGTGCGG - Intergenic
1195803680 X:108737998-108738020 AAGTAATAACTGGGGTGGTGGGG - Intergenic
1195889445 X:109676453-109676475 CAGCATTGCCTGGTGGGGGGCGG + Intronic
1196116216 X:112002315-112002337 CAGCATTTTTTTGGGGGGTGGGG + Intronic
1196835472 X:119809635-119809657 TAGCTTGAACTGGGGAGGTGAGG + Intergenic
1198723952 X:139656350-139656372 AAGCATTTACTGGCCGGGTGCGG - Intronic
1199446191 X:147924952-147924974 CAGCATGCACTGGGATGGTGGGG - Intronic
1199767545 X:150952241-150952263 TAGCAGTAGCTGGGGTGGTGAGG + Intergenic
1201059760 Y:10035678-10035700 CAGCATTGGCTGCTGGGGTGAGG + Intergenic