ID: 1135342272

View in Genome Browser
Species Human (GRCh38)
Location 16:21659150-21659172
Sequence GGAAATTCTGGCCGGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135342272_1135342276 -10 Left 1135342272 16:21659150-21659172 CCACCGCACCGGCCAGAATTTCC No data
Right 1135342276 16:21659163-21659185 CAGAATTTCCTTCCTTTTTAAGG No data
1135342272_1135342279 10 Left 1135342272 16:21659150-21659172 CCACCGCACCGGCCAGAATTTCC No data
Right 1135342279 16:21659183-21659205 AGGCTGAATAATCTATTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135342272 Original CRISPR GGAAATTCTGGCCGGTGCGG TGG (reversed) Intergenic