ID: 1135345303

View in Genome Browser
Species Human (GRCh38)
Location 16:21684226-21684248
Sequence ACAGCTAGTAAGTGTCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135345295_1135345303 24 Left 1135345295 16:21684179-21684201 CCTGTATTTTACCCAGCAACCCT No data
Right 1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG No data
1135345299_1135345303 4 Left 1135345299 16:21684199-21684221 CCTAGTTAAGTAACTCGTCCAAG No data
Right 1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG No data
1135345296_1135345303 13 Left 1135345296 16:21684190-21684212 CCCAGCAACCCTAGTTAAGTAAC No data
Right 1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG No data
1135345298_1135345303 5 Left 1135345298 16:21684198-21684220 CCCTAGTTAAGTAACTCGTCCAA No data
Right 1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG No data
1135345297_1135345303 12 Left 1135345297 16:21684191-21684213 CCAGCAACCCTAGTTAAGTAACT No data
Right 1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135345303 Original CRISPR ACAGCTAGTAAGTGTCAAGG TGG Intronic
No off target data available for this crispr