ID: 1135350064

View in Genome Browser
Species Human (GRCh38)
Location 16:21721375-21721397
Sequence ACCAAAAATGTTTGCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135350064_1135350075 30 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350075 16:21721428-21721450 TAGTGGGTAGAGGCCAGGGGTGG 0: 1
1: 5
2: 25
3: 87
4: 559
1135350064_1135350073 26 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350073 16:21721424-21721446 CCTCTAGTGGGTAGAGGCCAGGG 0: 7
1: 193
2: 686
3: 1140
4: 1521
1135350064_1135350074 27 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350074 16:21721425-21721447 CTCTAGTGGGTAGAGGCCAGGGG No data
1135350064_1135350071 25 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350071 16:21721423-21721445 GCCTCTAGTGGGTAGAGGCCAGG 0: 6
1: 172
2: 588
3: 1089
4: 1559
1135350064_1135350070 20 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350070 16:21721418-21721440 TACTGGCCTCTAGTGGGTAGAGG No data
1135350064_1135350069 14 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350069 16:21721412-21721434 CAGAGCTACTGGCCTCTAGTGGG No data
1135350064_1135350068 13 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350068 16:21721411-21721433 GCAGAGCTACTGGCCTCTAGTGG No data
1135350064_1135350066 3 Left 1135350064 16:21721375-21721397 CCATGTCTGCAAACATTTTTGGT No data
Right 1135350066 16:21721401-21721423 CACAACCGGAGCAGAGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135350064 Original CRISPR ACCAAAAATGTTTGCAGACA TGG (reversed) Intronic
No off target data available for this crispr