ID: 1135350838

View in Genome Browser
Species Human (GRCh38)
Location 16:21727760-21727782
Sequence CTGATCTTCCCCAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135350838_1135350842 -4 Left 1135350838 16:21727760-21727782 CCTGCATCCCTGGGGAAGATCAG No data
Right 1135350842 16:21727779-21727801 TCAGGTCCTGTTCCATCTCTAGG No data
1135350838_1135350844 5 Left 1135350838 16:21727760-21727782 CCTGCATCCCTGGGGAAGATCAG No data
Right 1135350844 16:21727788-21727810 GTTCCATCTCTAGGAATCCATGG No data
1135350838_1135350847 10 Left 1135350838 16:21727760-21727782 CCTGCATCCCTGGGGAAGATCAG No data
Right 1135350847 16:21727793-21727815 ATCTCTAGGAATCCATGGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 125
1135350838_1135350848 14 Left 1135350838 16:21727760-21727782 CCTGCATCCCTGGGGAAGATCAG No data
Right 1135350848 16:21727797-21727819 CTAGGAATCCATGGCAGGGTAGG No data
1135350838_1135350846 9 Left 1135350838 16:21727760-21727782 CCTGCATCCCTGGGGAAGATCAG No data
Right 1135350846 16:21727792-21727814 CATCTCTAGGAATCCATGGCAGG No data
1135350838_1135350850 29 Left 1135350838 16:21727760-21727782 CCTGCATCCCTGGGGAAGATCAG No data
Right 1135350850 16:21727812-21727834 AGGGTAGGCAGTTAAGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135350838 Original CRISPR CTGATCTTCCCCAGGGATGC AGG (reversed) Intronic
No off target data available for this crispr