ID: 1135354187

View in Genome Browser
Species Human (GRCh38)
Location 16:21755969-21755991
Sequence CAGGAGCCTGAACTGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135354178_1135354187 30 Left 1135354178 16:21755916-21755938 CCTGGAGTGAAGAATGCCATGTG No data
Right 1135354187 16:21755969-21755991 CAGGAGCCTGAACTGTGTTCTGG No data
1135354182_1135354187 14 Left 1135354182 16:21755932-21755954 CCATGTGTGAGGCTGGAGAGGTG No data
Right 1135354187 16:21755969-21755991 CAGGAGCCTGAACTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135354187 Original CRISPR CAGGAGCCTGAACTGTGTTC TGG Intronic
No off target data available for this crispr