ID: 1135358820

View in Genome Browser
Species Human (GRCh38)
Location 16:21793585-21793607
Sequence CAGCCAGATGCTCTGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135358814_1135358820 24 Left 1135358814 16:21793538-21793560 CCGTGTGATGTTGGGGTGGTGCT No data
Right 1135358820 16:21793585-21793607 CAGCCAGATGCTCTGTCATGAGG No data
1135358816_1135358820 -9 Left 1135358816 16:21793571-21793593 CCTTTTCCCGTCACCAGCCAGAT No data
Right 1135358820 16:21793585-21793607 CAGCCAGATGCTCTGTCATGAGG No data
1135358813_1135358820 25 Left 1135358813 16:21793537-21793559 CCCGTGTGATGTTGGGGTGGTGC No data
Right 1135358820 16:21793585-21793607 CAGCCAGATGCTCTGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135358820 Original CRISPR CAGCCAGATGCTCTGTCATG AGG Intergenic
No off target data available for this crispr