ID: 1135366567

View in Genome Browser
Species Human (GRCh38)
Location 16:21857326-21857348
Sequence CAGTTCCTGTCCCATGACCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 11, 1: 3, 2: 1, 3: 20, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135366567_1135366576 27 Left 1135366567 16:21857326-21857348 CCCTGGTCATGGGACAGGAACTG 0: 11
1: 3
2: 1
3: 20
4: 170
Right 1135366576 16:21857376-21857398 CATTTGCAGAATGAGAACAGGGG 0: 13
1: 0
2: 2
3: 37
4: 367
1135366567_1135366575 26 Left 1135366567 16:21857326-21857348 CCCTGGTCATGGGACAGGAACTG 0: 11
1: 3
2: 1
3: 20
4: 170
Right 1135366575 16:21857375-21857397 CCATTTGCAGAATGAGAACAGGG 0: 13
1: 1
2: 3
3: 35
4: 400
1135366567_1135366573 25 Left 1135366567 16:21857326-21857348 CCCTGGTCATGGGACAGGAACTG 0: 11
1: 3
2: 1
3: 20
4: 170
Right 1135366573 16:21857374-21857396 ACCATTTGCAGAATGAGAACAGG 0: 14
1: 0
2: 0
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135366567 Original CRISPR CAGTTCCTGTCCCATGACCA GGG (reversed) Exonic