ID: 1135367593

View in Genome Browser
Species Human (GRCh38)
Location 16:21866702-21866724
Sequence CTCCATCTTAAATAGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135367588_1135367593 22 Left 1135367588 16:21866657-21866679 CCGCAGTGGGCAATGATCATGTC No data
Right 1135367593 16:21866702-21866724 CTCCATCTTAAATAGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135367593 Original CRISPR CTCCATCTTAAATAGGAGCC GGG Intronic
No off target data available for this crispr