ID: 1135375653

View in Genome Browser
Species Human (GRCh38)
Location 16:21944744-21944766
Sequence AGTGTATGTTGGAGGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135375653_1135375663 6 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375663 16:21944773-21944795 GAATTGGGGGAGTGGAGGAGAGG No data
1135375653_1135375661 -2 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375661 16:21944765-21944787 CTTGATAGGAATTGGGGGAGTGG No data
1135375653_1135375660 -7 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375660 16:21944760-21944782 ATACACTTGATAGGAATTGGGGG No data
1135375653_1135375668 30 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375668 16:21944797-21944819 TTATCTGAGTTGGGGGCTGAAGG No data
1135375653_1135375657 -10 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375657 16:21944757-21944779 AACATACACTTGATAGGAATTGG No data
1135375653_1135375662 1 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375662 16:21944768-21944790 GATAGGAATTGGGGGAGTGGAGG No data
1135375653_1135375667 23 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375667 16:21944790-21944812 GAGAGGCTTATCTGAGTTGGGGG No data
1135375653_1135375665 21 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375665 16:21944788-21944810 AGGAGAGGCTTATCTGAGTTGGG No data
1135375653_1135375659 -8 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375659 16:21944759-21944781 CATACACTTGATAGGAATTGGGG No data
1135375653_1135375666 22 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375666 16:21944789-21944811 GGAGAGGCTTATCTGAGTTGGGG No data
1135375653_1135375664 20 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375664 16:21944787-21944809 GAGGAGAGGCTTATCTGAGTTGG No data
1135375653_1135375658 -9 Left 1135375653 16:21944744-21944766 CCTTTTGTCCTCCAACATACACT No data
Right 1135375658 16:21944758-21944780 ACATACACTTGATAGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135375653 Original CRISPR AGTGTATGTTGGAGGACAAA AGG (reversed) Intergenic
No off target data available for this crispr