ID: 1135376612

View in Genome Browser
Species Human (GRCh38)
Location 16:21952919-21952941
Sequence TACCCAATACCTCTGCAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135376607_1135376612 8 Left 1135376607 16:21952888-21952910 CCCAGCGAGAGGCAACTACGCCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1135376612 16:21952919-21952941 TACCCAATACCTCTGCAGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1135376605_1135376612 23 Left 1135376605 16:21952873-21952895 CCAGTAAGGACTTCACCCAGCGA 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1135376612 16:21952919-21952941 TACCCAATACCTCTGCAGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1135376608_1135376612 7 Left 1135376608 16:21952889-21952911 CCAGCGAGAGGCAACTACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1135376612 16:21952919-21952941 TACCCAATACCTCTGCAGAAAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135376612 Original CRISPR TACCCAATACCTCTGCAGAA AGG Exonic
907671932 1:56482888-56482910 GACATAATACCTATGCAGAATGG - Intergenic
912378336 1:109231152-109231174 TTGCCAATACATTTGCAGAAAGG - Intronic
914868004 1:151449177-151449199 TATACACTACATCTGCAGAAGGG + Intronic
919221107 1:194629695-194629717 TCCCCCATACCCCCGCAGAAAGG - Intergenic
920819476 1:209366931-209366953 TGCCCAATACCTCAGCCCAATGG - Intergenic
1064483960 10:15766217-15766239 TACCGAAAACCTGTGCAGAAGGG - Intergenic
1067930583 10:50556856-50556878 TAACCTTTACCTCTGCAGGACGG - Intronic
1068870218 10:61935364-61935386 TACATAAGAACTCTGCAGAAAGG + Intronic
1069200674 10:65611383-65611405 TAACTAATATCTCTGCAGACTGG - Intergenic
1071406180 10:85334770-85334792 TATCTAATACCTCATCAGAATGG + Intergenic
1075581670 10:123623508-123623530 TAACCAAAACCTCTGGAGCAAGG + Intergenic
1079845634 11:25462907-25462929 TACCCTATTCCTCTGCAGGATGG - Intergenic
1083027107 11:59560163-59560185 TCCCGTATACCTCTGCACAAAGG + Intergenic
1083312088 11:61789093-61789115 CACCCACCACCCCTGCAGAATGG + Exonic
1085431795 11:76458191-76458213 GACCTAATAGCTCTTCAGAATGG + Exonic
1086264061 11:84976972-84976994 TACCCAATTCCTCTACAAACCGG + Intronic
1087106286 11:94411166-94411188 TACCAGATTCCTTTGCAGAAAGG - Intergenic
1095179350 12:39129327-39129349 TACCCACTACATCTGTAGACAGG + Intergenic
1095264824 12:40143194-40143216 TACTGAATACCTAAGCAGAATGG + Intergenic
1100434665 12:94560774-94560796 GACCCTAGCCCTCTGCAGAAGGG + Intergenic
1101789327 12:107912964-107912986 TTCCCAATTCCGCTGGAGAAAGG - Intergenic
1104910460 12:132237882-132237904 GACCCAAAACCTCTGCATGAGGG + Intronic
1107236574 13:38177649-38177671 TAGTCACTACCTCTGCACAAAGG - Intergenic
1107948404 13:45440499-45440521 TAACAAATTCCTCTGCAGAACGG + Intergenic
1112232041 13:97598686-97598708 TACCAAATAACTTTCCAGAATGG - Intergenic
1112454999 13:99551986-99552008 TACCCAATTGCTCTTCAGATTGG - Intronic
1112955066 13:105047483-105047505 TCCCCATTATCTCTGCAGAGGGG + Intergenic
1113485910 13:110652267-110652289 TACCCACTTCCTCTGCAGGGTGG + Intronic
1118334487 14:64841334-64841356 GACCCAAGCCCTCTGCAGGAAGG + Intronic
1118914712 14:70093189-70093211 TAGCCAACACTTCTGCAGCATGG - Intronic
1118996947 14:70845142-70845164 TACCCAATACCTGTGTTTAATGG + Intergenic
1120706547 14:87751787-87751809 TTCACAATAGCTCTGGAGAAGGG - Intergenic
1121977130 14:98415777-98415799 TCCCAGATTCCTCTGCAGAAAGG + Intergenic
1126599024 15:50410199-50410221 TACACAGTACCTCTGTAGATAGG - Intergenic
1127997139 15:64159810-64159832 TTCCTGATACCTCTTCAGAATGG - Intronic
1129236693 15:74228012-74228034 ACCCCATTACCTCTGCAGAGAGG + Intergenic
1130203236 15:81852447-81852469 TACCAAATATCTCTGAAAAATGG - Intergenic
1132764968 16:1529708-1529730 TACCCAGGACCTCAGCATAAAGG - Intronic
1133743831 16:8672799-8672821 TACCCAATTTCCCTCCAGAAAGG + Intergenic
1135376612 16:21952919-21952941 TACCCAATACCTCTGCAGAAAGG + Exonic
1137262049 16:46839169-46839191 TACCCAATATCTTGGCAGACTGG + Intergenic
1137694288 16:50450855-50450877 AACTCCATCCCTCTGCAGAAGGG - Intergenic
1137749465 16:50848647-50848669 GACCCCATACCTCTTCAGGAAGG + Intergenic
1140895981 16:79324663-79324685 CACCCACCACCTCTACAGAAAGG + Intergenic
1142116184 16:88357282-88357304 TCCCCACCACCTCTGCAGAGAGG - Intergenic
1142468763 17:150467-150489 TGCCCAGTTCCTCTCCAGAAAGG + Intronic
1147987908 17:44316745-44316767 CACCCAGTACCCCTCCAGAAAGG + Intronic
1157234321 18:45949208-45949230 TACACAATTCCTGTGTAGAAAGG - Intronic
1158174955 18:54645213-54645235 TACCCAATCGTTCTTCAGAAAGG + Intergenic
1162469042 19:10861205-10861227 TACTCATTTCCTCTGCTGAACGG + Intronic
1164969792 19:32521954-32521976 ACCACACTACCTCTGCAGAATGG + Intergenic
1166027013 19:40095666-40095688 CACCCAATATCTCTGATGAAGGG + Intergenic
1166369145 19:42291704-42291726 TTCTCAGTACCTGTGCAGAATGG + Exonic
925171375 2:1752095-1752117 TAGCCAAGGCCTCTGCAGGAGGG + Intergenic
928373916 2:30759964-30759986 TGGCCAGTACCTCAGCAGAAGGG + Intronic
929304704 2:40347562-40347584 TTCCCAACACCTCTGTAAAATGG - Intronic
935646608 2:105341584-105341606 TACCCACTGCCTTTGTAGAAGGG - Intronic
936807184 2:116348990-116349012 TTCCCAATAACTATGCAGGATGG + Intergenic
941090679 2:161171329-161171351 TACCCTAAACATCTTCAGAATGG + Intronic
943189233 2:184654470-184654492 TAACCATAACCTCTGCAGCAAGG - Intronic
944175500 2:196824339-196824361 TACTCAATCCATCTGCTGAAAGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1175133810 20:56808415-56808437 TAGACATTACCTCTGCAGGAAGG - Intergenic
1178724187 21:35036656-35036678 TGACAAATGCCTCTGCAGAAAGG + Intronic
1182548358 22:31088407-31088429 TACCCAGAACCTTGGCAGAAGGG - Intronic
949372761 3:3353399-3353421 TGCCCAAGACCTCATCAGAATGG - Intergenic
950028409 3:9835828-9835850 GACCCATGCCCTCTGCAGAAGGG - Intronic
953912484 3:46899958-46899980 TTCACAGCACCTCTGCAGAATGG + Intronic
962241223 3:133752942-133752964 TGCCCAATCCCTCAGCAAAAGGG + Intronic
962705519 3:138039572-138039594 CACCCCATCCATCTGCAGAAAGG + Intergenic
965677776 3:171216542-171216564 TACCCTATTCATGTGCAGAATGG - Intronic
969168682 4:5340937-5340959 CACCCAATCTCTCTGCAAAATGG - Intronic
975963971 4:79946640-79946662 TACCAGATACCCCTGCAGGATGG - Intronic
980249515 4:130296312-130296334 TTCCCAATCACTTTGCAGAAAGG - Intergenic
981888816 4:149712712-149712734 TACTTAATACCTCTCCAGAATGG + Intergenic
983266215 4:165510918-165510940 TACACAAAACCTCTACAGATAGG + Intergenic
983913905 4:173270097-173270119 TGCGCTATACTTCTGCAGAATGG - Intronic
984661342 4:182378982-182379004 TACCCAATGCCTGTGCATACTGG - Intronic
990075188 5:51836810-51836832 GACCCAAAAGCTCTGCAGCAGGG + Intergenic
990162558 5:52958129-52958151 TACAGAATAGCTGTGCAGAAGGG + Exonic
992766062 5:80001566-80001588 TCCCCAAGCCCTCTGCAGATGGG - Intronic
995787845 5:115849645-115849667 TAAACAGTGCCTCTGCAGAAGGG + Intronic
995887705 5:116914988-116915010 TTCCCAGTACCTGTGAAGAAAGG + Intergenic
996835732 5:127789990-127790012 TGCCCAAAGGCTCTGCAGAATGG - Intergenic
999552148 5:152700921-152700943 TTCCCAATACCTCTGCTTCAAGG - Intergenic
1001339465 5:170830077-170830099 TACCCAATCCCTTTTCAGGATGG - Intergenic
1001512612 5:172334477-172334499 TACACAACAGCCCTGCAGAACGG + Exonic
1002260154 5:177987651-177987673 TACCCATTCCCTCTGAAGCACGG + Intergenic
1003643001 6:7891330-7891352 TACCCCATCTCTTTGCAGAACGG + Intronic
1006421062 6:33934462-33934484 CACCCAATACCTCTGGGGAGGGG - Intergenic
1009777825 6:68228405-68228427 TACACAATACCTCTAAACAACGG - Intergenic
1012965384 6:105667882-105667904 TACTAAATTCTTCTGCAGAAGGG - Intergenic
1020153159 7:5699554-5699576 CACCCACTACCTCAGCAGATTGG + Intronic
1024244324 7:47457725-47457747 TACGCTCTGCCTCTGCAGAAAGG - Intronic
1032340142 7:131063889-131063911 TACCAAATTCCTCTCCAGAGTGG - Intergenic
1033626263 7:143112649-143112671 TAGCCACAACCCCTGCAGAAAGG + Intergenic
1036986304 8:13534961-13534983 TCTCCTATACCTCAGCAGAAAGG - Intergenic
1037249459 8:16876321-16876343 TTCACAATACCTCTCCAGCAAGG - Intergenic
1037634352 8:20687793-20687815 TTCCCAAGACCTCTGAAGACCGG - Intergenic
1039392768 8:37195238-37195260 TACCAAATGCCTCTGCAGCAAGG + Intergenic
1043246617 8:78011157-78011179 TGCAAAATACCTCTGCATAAGGG + Intergenic
1048684999 8:136894863-136894885 TCACTAATCCCTCTGCAGAAGGG + Intergenic
1048991800 8:139764821-139764843 TCCCCAACACATCTGCAGACTGG - Intronic
1051668512 9:19487691-19487713 AAGCCAATAATTCTGCAGAAGGG + Intergenic
1052202837 9:25803339-25803361 TGCCCAGTCCCTCTGCAGATAGG - Intergenic
1054824966 9:69564569-69564591 TACCCAATACATGCTCAGAAGGG + Intronic
1188493825 X:30762905-30762927 AACCCAAAACCTCTTCAAAAAGG + Intergenic
1191055406 X:56234761-56234783 TTCCCCATAACTCTGAAGAATGG - Intronic
1194878489 X:99220008-99220030 TGCCTGATACCTCAGCAGAATGG + Intergenic