ID: 1135381194

View in Genome Browser
Species Human (GRCh38)
Location 16:21997493-21997515
Sequence GGCTCCGAAGTGAGTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135381190_1135381194 19 Left 1135381190 16:21997451-21997473 CCAACCAGACAGAGGCTGCTTCT No data
Right 1135381194 16:21997493-21997515 GGCTCCGAAGTGAGTAAAGCTGG No data
1135381191_1135381194 15 Left 1135381191 16:21997455-21997477 CCAGACAGAGGCTGCTTCTCAGA No data
Right 1135381194 16:21997493-21997515 GGCTCCGAAGTGAGTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135381194 Original CRISPR GGCTCCGAAGTGAGTAAAGC TGG Intronic
No off target data available for this crispr