ID: 1135386284

View in Genome Browser
Species Human (GRCh38)
Location 16:22043874-22043896
Sequence TTTATAAATTACCCAGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49982
Summary {0: 2548, 1: 10465, 2: 14335, 3: 13164, 4: 9470}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135386284_1135386287 -5 Left 1135386284 16:22043874-22043896 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1135386287 16:22043892-22043914 ATAAAGAAAAAGAGGTTTAATGG 0: 1338
1: 1566
2: 1040
3: 923
4: 2126
1135386284_1135386288 17 Left 1135386284 16:22043874-22043896 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1135386288 16:22043914-22043936 GACTCACAGTTCCACGTGACTGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083
1135386284_1135386291 22 Left 1135386284 16:22043874-22043896 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1135386291 16:22043919-22043941 ACAGTTCCACGTGACTGGGGAGG 0: 45
1: 1158
2: 6120
3: 7523
4: 6990
1135386284_1135386289 18 Left 1135386284 16:22043874-22043896 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1135386289 16:22043915-22043937 ACTCACAGTTCCACGTGACTGGG 0: 34
1: 969
2: 5547
3: 8202
4: 8230
1135386284_1135386290 19 Left 1135386284 16:22043874-22043896 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 1135386290 16:22043916-22043938 CTCACAGTTCCACGTGACTGGGG 0: 33
1: 933
2: 5305
3: 8080
4: 8275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135386284 Original CRISPR TTTATAAATTACCCAGTCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr